Skip to main content

Advertisement

Table 1 Primers sequences and real-time PCR conditions used to detect Plasmodium species

From: An innovative tool for moving malaria PCR detection of parasite reservoir into the field

Real-time PCR name Primer name Sequence (5′-3′) Master mix Assay parameters Melt parameters T° melt peak
Real-time PCR screening RTPCRScreening2_F TGGAGTGGATGGTGTTTTAGA Hot FirePol EvaGreen qPCR Mix Solis Biodyne 1X (#08-24-00020), Primers 150 nM, 5 μl DNA template, Total volume 20 μl 95°C-15 min 45 cycles: 95°C-15 sec/60°C-20 sec/72°C-20 sec 95°C-2 min 68°C-2 min From 68 to 90°C, increment 0.2°C for 0.05 sec 76.4-78.4°C
RTPCRScreening2_R TTGCACCCCAATARCTCATTT
Nested real-time PCR species Primary PCR RTPCRScreening2_F TGGAGTGGATGGTGTTTTAGA Hot FirePol DNA Pol. Solis BioDyne 1.25 U (#01-02-01000), dNTP 200 μM, MgCl2 2.5 mM, Primers 250 nM, 5 μl DNA template. Total volume 20 μl. 94°C -15 min 20 cycles: 94°C-30 sec/ 58°C -1 min/ 72°C-1 min 72°C-10 min N/A N/A (PCR product size: 400 bp)
RTPCRSreening3_R ACCCTAAAGGATTTGTGCTACC
Nested real-time PCR Pf Pf_RTPCR_F ATGGATATCTGGATTGATTTTATTTATGA Hot FirePol EvaGreen HRM Mix Solis Biodyne 1X (#08-33-00001), Primers 250 nM, 5 μl template Primary PCR products 1:10, Total volume 20 μl 95°C-15 min 35–45 cycles*: 95°C-10 sec/62°C-20 sec/72°C-25 sec 95°C-1 min 40°C-1 min From 65 to 90°C, increment 0.2°C for 0.05 sec. 78.6-79.6°C
Pf_RTPCR_R TCCTCCACATATCCAAATTACTGC
Nested Real-time PCR Pv Pv_RTPCR_F TGCTACAGGTGCATCTCTTGTATTC 74.8-75.8°C
Pv_RTPCR_R ATTTGTCCCCAAGGTAAAACG
Nested real-time PCR Pm Pm_RTPCR_F ACAGGTGCATCACTTGTATTTTTTC 75.4-76.4°C
Pm_RTPCR_R TGCTGGAATTGAAGATAATAAATTAGTAATAACT
Nested Real-time PCR Po Po_RTPCR_F GTTATATGGTTATGTGGAGGATATACTGTT 73.2-74.2°C
   Po_RTPCR_R CGAATGGAAGAATAAAATGTAGTACG     
  1. *35 cycles when nested real-time PCR, 45 cycles when real-time PCR alone.