Skip to main content

Table 2 Primer sequences. Lower case nucleotide indicates the intentional mismatch, nucleotides in bold are located at site of SNP (where applicable), F and R indicate forward and reverse orientation.

From: IMP PCR primers detect single nucleotide polymorphisms for Anopheles gambiae species identification, Mopti and Savanna rDNA types, and resistance to dieldrin in Anopheles arabiensis

An. gambiae species ID (5' to 3')Fragment (size bp)
IMP-UN: F GCTGCGAGTTGTAGAGATGCG  
  R GCATGTCCACCAACGTAAAtCC An. quadriannulatus (637)
QD-3T R CAACCCACTCCCTTGACGaTG An. melas and merus (529)
ME-3T R GCTTACTGGTTTGGTCGGCAtGT An. gambiae (464)
GA-3T AR-3T R GTGTTAAGTGTCCTTCTCCgTC An. arabiensis (388)
Mopti/Savanna rDNA typing
M5 F CTTGGTCTGGAGACCGTTCCaTA Mopti (426)
M3 R GACACGTCAACTAAGTCAACACATtAC  
S5 F GCCCCTTCCTCGATGGaGC Savanna (335)
S3 R CAACCGGCCCAAACGGcTT  
Rdl mutation assay
RDLF F AGTTTGTACGTTCGATGGGTTA positive control (256)
RDLR R CCAGCAGACTGGCAAATACC  
AARDL F GCTACACCAGCACGTGaTT dieldrin resistant (158)
RDLSS R CAAGACAGTAGTTACACCTAAaGC dieldrin susceptible (121)