Skip to main content

Advertisement

Table 1 Primers used for the various mutagenic protocols. The Bam HI restriction sites for primer pairs P3 and P4 are underlined. The P3 primer pair was used with and without Bam HI restriction digestion for the RE-mediated inverse PCR and inverse PCR methods, respectively.

From: Deletion mutagenesis of large areas in Plasmodium falciparum genes: a comparative study

Primer Pair Primer Length (bp) Tm* (°C) Primer Sequence (5' to 3') Mutagenesis method
P1 A3consF 43 78 gctttatgatagtagtgatgctgataattataataaggaaagc QuickChange™ site-directed method
  A3consR 43 78 gctttccttattataattatcagcatcactactatcataaagc  
P2 A3overF 49 79 gatagtagtgatgctgat ↓ aattataataaggagagctttttatataatg Overlapping primer method [19]
  A3overR 55 80 gctttccttattataatt ↓ atcagcatcactactatcataaagctttaaattatcc  
P3 A3reF 27 73(62) cgcggatcc aattataataaggaaagc ExSite™, inverse [18] and RE-mediated inverse PCR methods
  A3reR 34 79(69) cgcggatcc atcagcatcactactatcataaagc  
P4 PdxkF 34 78(67) cgcggatcc aatctaaattttctttgggtatgtg RE-mediated inverse PCR method
  PdxkR 38 79(67) cgcggatcc tttccttcttaattcaagtatatttttgg  
  1. * The Tm's were calculated according to the Stratagene formula: 81.5 + 0.41(%GC) - 675/N) or for primer pairs P3 and P4 with the Rychlik et al. formula: 69.3 + 0.41(%GC) - (650/N) [26] as indicated in parentheses.
  2. ↓ indicates where the deletions are made with the overlapping primers.