Skip to main content

Advertisement

Table 1 Specific gene primers used for Q-RT PCR. Primers used to specifically amplify var genes, a pseudogene and control genes in Q-RT PCR, in addition to primer sets designed by Salanti et al. [18]. Primers from Salanti et al. that were used in this study (but not shown in table): no. 4–12, 15, 17–23, 25–28, 30, 34–39, 41, 43, 45, 46, 49–55, 91–96, and 97.

From: Changes in var gene mRNA levels during erythrocytic development in two phenotypically distinct Plasmodium falciparum parasites

Primer set Forward primer Reverse primer Target gene
1 new TAAATTGCTCAATCGCGAAG CATCGTCATCATCGTCATCA PFA0005w
16 AAAGCCACTAGCGAGGGTAA TGTTTTTGCCCACTCCTGTA PFL1955w
24 AGGACAACACGGATGAGACA AGCAGTGTTGTCGCCATTAG PFC0005w
32 ACCTAATGGCGAAAACCAAG ACACTTGCCTTCATCCACTG PFD1000c
44 new CCTACACTCACCTCCCCCTA ACACTCACACGCCTCATCAT PFF1580c
58 new ACAACAATTTCGCAAGCAAG TTCCTCTGCCTCCTCTTCAT PFI1830c
66 CCTAAAAAGGACGCAGAAGG CCAGCAACACTACCACCAGT PF08_0107
67 AAGGGAAGATTGGTGGACAG AGGGGGATCAGTATCACGTC PFF0020c
90a TCAATTTGATAAAGTGGAACAATTC GCGTTGTTTAAAGCTCCTGA PF07_0073
98 ATGGTGGCAAACTTGTGAGA TCCAATTGGTCTCCTTGACA PF08_0140
99 AGGGAGCATCAGGTGGTAGT GCTGTGCATGCTTTTTCATT MAL7P1.50
100 GATCAAAAGAGGCGGAGAAG TTCCAATTGGGGAATTTTTC PFI0005w
101 CAAGAGACACAACCGGAAGA CACTTCCAATTGGGGAATTT PFA0765c
498/499 AATCAGAAAAGTGTAATTGCAGGAG TTTACTATCATCACTGACACGCATT MAL7P1.212
500/501 GTCCTCTATGTGGAGTGAAAAAGAA AGTACCGTTATCTGGGTTTATAGGC MAL8P1.220
392/393b AAACGAAAGCGAAGCAGAAT CACCTTCACTCCTTGCCATA PFF0005c
334/335 AGCCCAATCGGAAGGTAAGT TTCATAGCTTCTAGCGCCTT PFL0030c
UTR var2csa CACGACATTAACAATACATGCAGA CATTGCATTCACAGACATTGG PFL0030c
390/391c AATAATACCAGTGACATTCTGCAAAA ACACGTAAAAGGTCCACAGGTG PFL0030c
535/536c CCAGCAGGACCAGCAACAGATAGTGGC CCACTTCTATATGGTATGTACCTATTTTTG PFL0935c
496/497c AATCACTTCCGCAACCCCCACG CTGAAAAGGTCCACACGAGG PFD0615c
MSP1 ACAACTGAAGATGGGGGTCA TTTTGGTGGTGATGGTTGTG PFI1475w
  1. a. Endogeneous control gene, seryl-tRNA synthetase.
  2. b. Pseudogene.
  3. c. Primers designed to target flanking regions of the intron (cross-intron primers).