Skip to main content

Table 1 Primer sequences of the microsatellite markers used for differentiating recrudescences from reinfections in paired samples from enrolled patients with treatment failure after day 7.

From: Plasmodium vivax dhfr and dhps mutations in isolates from Madagascar and therapeutic response to sulphadoxine-pyrimethamine

Micro satellite markers Motif External PCR Internal PCR Label
14.185§ AT F: TGCAGATATGCTGTCGAAT F: GCAGTTGTTGCAGATTGAGC 6FAM
   R: GGGAAAAACTTGGTCACAC R: TAAGGCGTGCACGTTATCAT  
8.332§ AT F: TGAAGCAATATAGCGATGAC F: CCTCGATGGTGATGTGATGA HEX
   R: CGGTGTAGTGTGGTACAATG R: GTATAACATGGCACCCGACCT  
6.34§ AC F: CCCAATTAAGTGCAAATCA F: TGAGCGCTTTAAGCTTCTGC 6FAM
   R: CATGTAAAGAGGCACATGG R: CAAAAATGAATCGTGGCACA  
2.21§ AC F: GGCAGGAACGTAGAGGAG F: CCATCTGCTCAAATCCGAAG 6FAM
   R: GGCTTGTTCATTTTGAGGTA R: GGCTCCTCCCTGTCTCTGTAG  
AY391734# CA F: TACCCCAGCCTTATCTCTC F: TTTTCCCTTCGGAAAAACG 6FAM
   R: AAATGCACAGACACTACGC R: ACGACCATCACCTGCCATAG  
AY391740# AC F: ATTTGTGTATGCCTTGTGTT F: GTTTACCAGGCCCAATTCAC HEX
   R: GTGAGGGTGTCTATCCGTA R: GTTCACACGGGCGTATACAT  
  1. § microsatellites sequences described by Imwong et al, 2006 [20]
  2. # microsatellites sequences described by Leclerc et al, 2004 [19]
  3. Primers sequences were designed by primer3 software [39]
  4. F: forward primer
  5. R: reverse primer