Skip to main content

Advertisement

Table 2 Primers used in Nested PCR reactions.

From: Anti-Anopheles darlingi saliva antibodies as marker of Plasmodium vivax infection and clinical immunity in the Brazilian Amazon

Primer Oligonucleotide Sequence 5'-3' Base pairs
PLU5 CCTGTTGTTGCCTTAAACTTC 1,200
PLU6 TTAAAATTGTTGCAGTTAAAA  
Fal1 TTAAACTGGTTTGGGAAAACCAAATATATT 205
Fal2 ACACAATGAACTCAATCATGACTACCCGTC  
Viv1 CGCTTCTAGCTTAATCCACATAACTGATAC 120
Viv2 ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA  
Mal1 ATAACATAGTTGTACGTTAAGAATAACCGC 144
Mal2 AAAATTCCCATGCATAAAAAATTATACAAA  
  1. PLU: Plasmodium sp, Fal: Plasmodium falciparum, Viv: Plasmodium vivax, Mal: Plasmodium malariae.