Skip to main content

Advertisement

Table 2 Primers sequences

From: Characterization of the repertoire diversity of the Plasmodium falciparum stevor multigene family in laboratory and field isolates

Primer name Direction Primer Sequence (5'-3') Tm (°C)
Smf1 sense GAYSCAGAACTCAARGAAATWATT 46.42
Smr1 antisense GCAGMACCAAAGYWGYAATACC 47.9
JBSTEVORF1 sense AGATGTACCCGTGGTATATGTTCTTGCA 54.96
JBSTEVORR1 antisense GCTAATATAAGTAGAACCAAAGCTGCAATAC 54.44
RepF1 sense AGATGAATTCGTGGTATATRTTYTTGYTC 55.84
RepF2 sense AGATGAATTCGGGGTTTAGTTGTGTGTGC 63.86
RepR antisense TTTAGGATCCAGAACCAAARYTGCAATACC 62.21