Skip to main content

Table 1 List of microsatellites and PCR primers used for microsatellites amplification

From: Effects of transmission reduction by insecticide-treated bed nets (ITNs) on parasite genetics population structure: I. The genetic diversity of Plasmodium falciparum parasites by microsatellite markers in western Kenya

MS§ name MS primer sequence 5'-3' MS linked genes Acc. No.¥ of linked genes Chromosome
Poly-αa AAAATATAGACGAACAGA DNA polymerase alpha L18785 4
  GAAATTATAACTCTACCA    
Pfg377a GATCTCAACGGAAATTAT Gametocyte specific protein L04161 12
  TTATCCCTACGATTAACA    
PfPK2a CTTTCATCGATACTACGA Protein kinase X63648 12
  AAAGAAGGAACAAGCAGA    
ADL b TACAGTGTTTATATATACCG Fructose bisphosphate aldolase M28881 14
  GCATAAATAATGTGAGCAGA    
EBP b TTCACAAGCCAAATATCA Erythrocyte binding protein M93397 13
  ATTCATAACTCCTTCAGA    
P195 b GAGTTAAAATATGTTACCT Merozoite surface protein-1 X02919 9
  AAATATCACTATTCCTGT    
TAA60a TAGTAACGATGTTGACAA Hypothetical protein AF010556 13
  AAAAAGGAGGATAAATACAT    
TAA109a TAGGGAACATCATAAGGAT Hypothetical protein AF010508 6
  CCTATACCAAACATGCTAAA    
  1. MS§ depicts microsatellites. Acc. No.¥ depicts Accession number. The letters in superscript depict the initial description of microsatellites as follows: (a) by [37], (b) by [36].