Skip to main content

Table 1 Primers and sensitivity for amplifying Plasmodium from faecal samples

From: Non-invasive surveillance for Plasmodium in reservoir macaque species

ID Primer sets Nest?a Sequence Product length (bp) Gene Reference for primers
ssrRNA PfF4595
PfR5019
reamp GATTACAGCTCCCAAGCAAAC
GTTTAGCCAGGAAGTCAGCGTC
424 ssrRNA This paper
cytb1 PfF3700
PfR4615
nest1a TGGATGGTGTTTTAGATACATGC
GTTTGCTTGGGAGCTGTAATC
915 cytb This paper
cytb1 PfF3700
PfR4102
nest2a TGGATGGTGTTTTAGATACATGC
GCTGTATCATACCCTAAAG
402 cytb This paper
cytb2 PfF3368
PfR4102
nest1b TGCCTAGACGTATTCCTGAT
GCTGTATCATACCCTAAAG
734 cytb This paper
cytb2 PfF3368
PfR3717
nest2b TGCCTAGACGTATTCCTGAT
TATCTAAAACACCATCCACTCCA
349 cytb This paper
cytb3 qPlasm1f
qPlasm1r
nest1c CTGACTTCCTGGCTAAACTTCC
CATGTGATCTAATTACAGAAYAGGA
170 cytb [32]
cytb3 qPlasm2f
qPlasm2r
nest2c AGAAAACCGTCTATATTCATGTTTG
ATAGACCGAACCTTGGACTC
90 cytb [32]
  1. Primers are all listed in the 5′ to 3′ end
  2. aNested reactions are indicated: the first primer set is denoted with ‘1’ and the second set is denoted with ‘2’, and nested primer sets can be differentiated by the letter following the number. Sensitivity is only given for the complete nested reaction. The primer set targeting the ssrRNA segment was used twice in a re-amplification reaction to increase yield