Skip to main content

Table 2 Primers and profiles used for amplification of pvdhps gene

From: Mutations of pvdhfr and pvdhps genes in vivax endemic-malaria areas in Kota Marudu and Kalabakan, Sabah

Primer pairs (5′–3′) Concentration of Mg2 (mM) Concentration of primer (nM) Annealing Temperature (°C/Min) Cycle Size (bp)
VDHPS OF: ATTCCAGAGTATAAGCACAGCACATTTGAG
VDHPS OR: CTAAGGTTGATGTATCCTTGTGAGCACATC
2.0 250 69/2 21 1354
VDHPS NF: AATGGCAAGTGATGGGGCGAGCGTGATTGA
VDHPS NR: CAGTCTGCACTCCCCGATGGCCGCGCCACC
2.0 250 70.5/2 25 703
VDHPS 553OF: TTCTCTTTGATGTCGGCCTGGGGTTGGCCA
VDHPS NR: CAGTCTGCACTCCCCGATGGCCGCGCCACC
2.0 250 69.5/1 30 170