Skip to main content

Table 1 Primer sequences for qRT-PCR analysis

From: An external sensing system in Plasmodium falciparum-infected erythrocytes

Name Primer sequences
PCNA1 Forward: 5′ AGTAGGTGATGCTGAAGTAGC 3′
Reverse: 5′ CCTAAGACAACGACATCTGCT 3′
PCNA2 Forward: 5′ AGGTGTGATAAAAATTGCGTTT 3′
Reverse: 5′ TCGTCAGCACTTGATTGTTC 3′
EXP2 Forward: 5′ AGATGGTCACGTATGTGGTG 3′
Reverse: 5′TGGTTTGGATTCTACGGCAT 3′
HSP86family Forward: 5′ ACCAAGAAGAGGAGAAGTTGG 3′
Reverse: 5′ GCTCTTTGTTCTTCTGCACT 3′
ANP32 Forward: 5′ ACAGACCTTAGAAAATATCCCATCA 3′
Reverse: 5′ TGGTTTCCACCTATTTCAAGGG 3′