Skip to main content

Table 1 Primers for detection of human blood, bovine blood and malaria parasites

From: Anopheles subpictus carry human malaria parasites in an urban area of Western India and may facilitate perennial malaria transmission

Species Target gene Primer name Sequence (5′–3′) PCR product size (bp) References
Homo sapiens (human) rDNA HUM1 CGAGAGTTC//TCTGGAAGAATTGA 519 Mohanty et al. 2007 [16]
HUM2 TGATAGCCTGGAAGTGACAAAAT
Bovine Bos taurus mtDNA B1 CATCATAGCAATTGCCATAGTCC 165 Corona et al. 2007 [20]
B2 GTACTAGTAGTATTAGAGCTAGAATTAG
Plasmodium (genus-wide) 18S rRNA rPLU5 CCTGTTGTTGCCTTAAACTTC 1100 Johnston et al. 2006 [18]
rPLU6 TTAAAATTGTTGCAGTTAAAACG
P. falciparum (species specific) 18S rRNA rFAL1 TTAAACTGGTTTGGGAAAACCAAATATATT 205
rFAL2 ACACAATGAACTCAATCATGACTACCCGTC  
P. vivax (species specific) 18S rRNA rVIV1 CGCTTCTAGCTTAATCCACATAACTGATAC 120
rVIV2 ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA