Skip to main content

Table 1 The primers and probe used for copy number quantification

From: Plasmodium copy number variation scan: gene copy numbers evaluation in haploid genomes

Name Sequence Gene amplification Location
CytbF 5′GCACGCAACAGGTGCTTCTC 3′ Cytochrome b Mitochondira
CytbR 5′GACCCCATGGTAAGACATAACC 3′
CytBP 5′(FAM)-CCATGATAATGGTAAATACATATATGAGTAATTT-(TAMRA) 3′
CLCPF 5′GGGCCTAGTGGTACTGGTAA 3′ clcp Apicoplast
CLCPR 5′CCAACATAACCAGGAGGTGAACC 3′
CLCPP 5′(FAM)-CATATCAAATCTAATTAGTTCTTTTTCAGAACC-(TAMRA) 3′
Mdr1F 5′ TGCATCTATAAAACGATCAGACAAA 3′ pfmdr1 Nuclear
Mdr1R 5′ TCGTGTGTTCCATGTGACTGT 3′
Mdr1P 5′ (FAM)-TTTAATAACCCTGATCGAAATGGAACCTTTG-(TAMRA) 3′
TubF 5′AAAAATATGATGTGCGCAAGTGA 3′ Pftubulin
TubR 5′AACTTCCTTTGTGGACATTCTTCCT 3′
TubP 5′ (TET)-TAGCACATGCCGTTAAATATCTTCCATGTCT-(TAMRA) 3′