Skip to main content

Table 1 Primers in real time PCR

From: Identification and characterization of DNA endonucleases in Plasmodium falciparum 3D7 clone

Genes ID Forward primer Reverse primer
PF3D7_1238600 TTCCGGATGTATTTTGTTCC CCCATTTGCTTAATTCATCG
PF3D7_0107200 CAGTTTATCCTTTTGAATATAATTAT TGTTCAGGAGTATGTAAGATAAAAT
PF3D7_1363500 AGAAAACAACTTAATGCTATGTC TGTCGAAAGTGGGTAAATTG
PF3D7_0305600 TAGACACTCAGGAATCGCAAGAAT CCATAAGTTTGGTTTCTTTGTGAC
PF3D7_0319200 ACGGCTAGCCAAAGTAAC GAATTCTGTTCCTCGTTTTT
PF3D7_0519500 AGTCCGGATATAGTATGTTTGC CCCTCCTCTCCTTTTTCCT
PF3D7_1430600 AGCTGGAATGTAAATGGTTG ACTGATTCGTTCGTTTTGGT