Skip to main content

Advertisement

Table 2 Primer sequences and amplification conditions used for nested PCR of pmcsp

From: Genetic polymorphisms in the circumsporozoite protein of Plasmodium malariae show a geographical bias

Primer name Sequences (5′ to 3′) Annealing temperature (°C) No. of PCR cycle Product size (bp)
Nest 1 Nest 2
PmCSF1 ATGAAGAAGTTATCTGTCTTAGC 50 30   1300
PmCSR1 TTAGTGAAAGAGTATTAAGACT     
PmCSF2 TTGATTTCCTCTTCCCTGGAT 52   35 1250
PmCSR1 TTAGTGAAAGAGTATTAAGACT