Skip to main content

Table 1 Primer sequences and amplification conditions of pfhrp2 and pfhrp3 genes, and their respective flanking sequences

From: Deletions of pfhrp2 and pfhrp3 genes of Plasmodium falciparum from Honduras, Guatemala and Nicaragua

Target sequence Reaction Primer Primer sequence Annealing temp (°C) Amplicon size (bp)
pfhrp2 UPSTREAM PF3D7_0831900, (MAL7P1.230) Primary 230F1 5′GATATCATTAGAAAACAAGAGCTTAG3′ 63 301
pfhrp2 Exon 1–2, PF3D7_0831800 Primary 2E12F1 5′GGTTTCCTTCTCAAAAAATAAAG3′ 55 228
pfhrp2 DOWNSTREAM PF3D7_0831700, (MAL7P1.228) Primary 228F 5′AGACAAGCTACCAAAGATGCAGGTG3′ 60 198
pfhrp3 DOWNSTREAM PF3D7_1372100, (MAL13P1.485) Primary 485F 5′TTGAGTGCAATGATGAGTGGAG3′ 60 241
Semi-nested 485F1 5′GTTACTACATTAGTGATGCATTC3′ 59  
pfhrp3 Exon 1–2, PF3D7_1372200 Primary 3E12F1 5′GGTTTCCTTCTCAAAAAATAAAA3′ 53 225
pfhrp3 UPSTREAM PF3D7_1372400, (MAL13P1.475) Primary 475F 5′TTCATGAGTAGATGTCCTAGGAG3′ 55 212
pfhrp2 Exon 2 Primary Pfhrp2F1 5′CAAAAGGACTTAATTTAAATAAGAG3′ 55 600–950
Semi-nested Pfhrp2F2 5′ATTATTACACGAAACTCAAGCAC3′ 55  
pfhrp3 Exon 2 Primary Pfhrp3F1 5′AATGCAAAAGGACTTAATTC3′ 55 600–950
Semi-nested Pfhrp3F2 5′AAATAAGAGATTATTACACGAAAG3′ 55