Skip to main content

Advertisement

Table 1 Primers used for shark VNAR library construction and sequencing

From: Isolation and characterization of malaria PfHRP2 specific VNAR antibody fragments from immunized shark phage display library

Primers description Nucleotide sequence (5′→3′) Applications
Leader-F ATGAATATTTTCTTGCYGTCAGTCC 1st PCR
C-DomainR CCTCTCTGTTCTTCRGTTGCAGAGT 1st PCR
FR1F1 RCAWGGGTRGACCAAACACC Nested PCR
FR4R TTTCACGGTYARTRCGGTGCC Nested PCR
T7SelectUP (For) GGAGCTGTCGTATTCCAGTC T7 Phage sequencing
T7SelectDOWN (Rev) AACCCCTCAAGACCCGTTTA T7 Phage sequencing
T7Seq_For TAATACGACTCACTATAGGG pET vector sequencing forward
T7Seq_Rev CTAGTTATTGCTCAGCGGTG pET vector sequencing reverse
  1. Association (ka), dissociation rates (kd), and equilibrium constants (KD) of mAbs D2, F9, and C1–13 against rPfHRP2. The analysis for mAbs D2 and F9 were undertaken using the Octet Red platform, whereas mAb C1–13 was determined by BIAcore