Temporal changes in Plasmodium falciparum reticulocyte binding protein homolog 2b (PfRh2b) in Senegal and The Gambia

Diédhiou, Cyrille K.; Moussa, Rahama A.; Bei, Amy K.; Daniels, Rachel; Papa Mze, Nasserdine; Ndiaye, Daouda; Faye, Ngor; Wirth, Dyann; Amambua-Ngwa, Alfred; Mboup, Souleymane; Ahouidi, Ambroise D.

doi:10.1186/s12936-019-2868-x

Table 2 Nucleotide sequence of haplotype clusters in Thiès

From: Temporal changes in Plasmodium falciparum reticulocyte binding protein homolog 2b (PfRh2b) in Senegal and The Gambia

Haplotype cluster	Molecular barcodes	N (%)	N (isolats)	PfRh2bdel (%)	PfRh2bfull (%)
Haplotype cluster 36	CACTGCAGACCGCACCCAAGCCTG	0.345	2	100	0
Haplotype cluster 38	CACTCGAGATCGTCACCACGCTTG	0.345	2	0	100
Haplotype cluster 45	TATTCCGGTCCGTCCCCTCGCTTG	0.345	2	100	0
Haplotype cluster 51	TACTCCGGTTCGCACACACGACTG	0.345	2	100	0
Haplotype cluster 49	TATTCGAAATCGCACCCTAGATTG	0.345	2	100	0
Haplotype cluster 48	TACTCCAGTCCATACACACGATTG	0.345	2	100	0
Haplotype cluster 46	TACTGCAGATTGTACCCAAAACTG	0.345	2	50	50
Haplotype cluster 57	CACTGCGGATTGTACCTAAGACTG	0.345	2	50	50
Haplotype cluster 54	CGCTCCAGACTACACCCTAAACTG	0.345	2	0	100
Haplotype cluster 53	TACTCCGGATTGTCACCAAGACTG	0.345	2	100	0
Haplotype cluster 59	TACTCCGGTTTATACCTTAGACTG	0.345	2	0	100
Haplotype cluster 61	TACCGGAGTCCGTACCTAAGCCTG	0.345	2	0	100
Haplotype cluster 15	TACTCCGGTTCGTAAACTCGCCTG	0.345	2	50	50
Haplotype cluster 63	TACTCCAGACCGCCCCTAAAATTG	0.345	2	0	100
Haplotype cluster 9	TATTCCAGATXGCAACTTCGACTG	0.345	2	100	0
Haplotype cluster 62	TACTCGAGACTGCNCATACACTTG	0.345	2	0	100
Haplotype cluster 13	TACTCGAAACTXCCCATAAGCTTG	0.345	2	0	100
Haplotype cluster 68	TACCCCGGACCACCAATAAGACTG	0.345	2	0	100
Haplotype cluster 69	TACTGGGATCCGCACCTAAGACTG	0.345	2	0	100
Haplotype cluster 67	CACTCCGGATTGCCACTTAGATTG	0.345	2	50	50
Haplotype cluster 70	TATTCCGGACXACACACTAGCTTG	0.345	2	0	100
Haplotype cluster 22	TACTCCGGATCGCACCCTAGATTG	0.345	2	50	50
Haplotype cluster 74	TACTCCAGACTATCCATTCGATTG	0.345	2	50	50
Haplotype cluster 71	CACTCGGGATTXCCACTAAGCTTG	0.345	2	0	100
Haplotype cluster 80	CATTCCAGTCCXCCAATAAGATTG	0.345	2	0	100
Haplotype cluster 72	TATTGGGGATCGCAACCAAGATTG	0.345	2	100	0
Haplotype cluster 77	TACTGGAGTCCGTACCTTAGCTTG	0.345	2	50	50
Haplotype cluster 97	CACTCGAAATXATACCTTAGCTTG	0.345	2	50	50
Haplotype cluster 87	TACTCGGGTCTATAAATAAGACTG	0.345	2	0	100
Haplotype cluster 89	TACTCGAGTTTATACCTTAGACTG	0.345	2	0	100
Haplotype cluster 92	TATTGCAGTCCXCAAATAAGCTTG	0.345	2	0	100
Haplotype cluster 84	CACTCCAGTCCACCACNTAGATTG	0.345	2	100	0
Haplotype cluster 96	TATTCCAGACCGCACATTAGCCTG	0.345	2	50	50
Haplotype cluster 93	TACTCCAGTCCGTCACTTAGACTG	0.345	2	100	0
Haplotype cluster 44	TACTCCAGACTACAACTACGCCTG	0.345	2	0	100
Haplotype cluster 43	TATTCCAGATTGCAACTTCGCCTG	0.517	3	100	0
Haplotype cluster 58	CACTCGAGTTXACAACCTAGCCTG	0.517	3	33	67
Haplotype cluster 7	CACTCCGGATTGCCACTAAGATTG	0.517	3	33	67
Haplotype cluster 19	TATTCGAGTCTACACCTTCACTTG	0.517	3	100	0
Haplotype cluster 21	TACCCCGGTCCACCACTAAAATTG	0.517	3	0	100
Haplotype cluster 23	CACCCGAGTCCACCAACAAGACTG	0.517	3	0	100
Haplotype cluster 95	CACCCCGAATCXCACCTAAGACTG	0.517	3	0	100
Haplotype cluster 99	TACTCCGAACTGCACATTAGATTG	0.517	3	100	0
Haplotype cluster 55	TACTCCGGTTTGCACACACGACTG	0.69	4	100	0
Haplotype cluster 64	TACTCGAGATXATACATACACTTG	0.69	4	0	100
Haplotype cluster 10	CATTGCGATCTGCAACCTAAACTG	0.69	4	100	0
Haplotype cluster 24	CATTCCAGTCCXCCCATTAGATTG	0.69	4	25	75
Haplotype cluster 81	TACTCCAGATCGCACCCAAGCCTG	0.69	4	75	25
Haplotype cluster 98	CACTCGAGTTTACAACTAAGATTG	0.69	4	25	75
Haplotype cluster 5	TACTCGAAACTGCCCATAAGCTTG	0.69	4	0	100
Haplotype cluster 65	CACTCCAAATCGTACCTTAGATTG	0.862	5	100	0
Haplotype cluster 8	TACCCCGGTCCACACCTTAACTTG	0.862	5	100	0
Haplotype cluster 11	TACTCGAGATCATACATACACTTG	0.862	5	0	100
Haplotype cluster 12	CACTGCGATCTGCAACCTAAACTG	0.862	5	100	0
Haplotype cluster 6	CATTCCAGTCCGCCAATAAGATTG	1.034	6	0	100
Haplotype cluster 26	CACTCCAGTCCGTCACCAAGATTG	1.034	6	17	83
Haplotype cluster 17	TACCCCGGTCCACCAATAAGATTG	1.207	7	0	100
Haplotype cluster 16	TACTCCAGATTACAACCTAGCCTG	1.207	7	100	0
Haplotype cluster 66	TGTTCCAGTTTATCACCACGCCTG	1.379	8	12.50	87.50
Haplotype cluster 18	TATTCCAGTCCACCCATAAGACTG	1.552	9	89	11
Haplotype cluster 4	TACTCCGGTTXGCACACACGACTG	2.586	15	100	0
Haplotype cluster 29	TACCCCGGTCCACCAATAAGACTG	7.241	42	9.50	90.50
	UNIQUES	58.27	338	49.11	50.89

N, number of isolates; PfRh2bdel, deletion present; PfRh2bfull, full-length sequence

Back to article page

ISSN: 1475-2875

Contact us

Submission enquiries: journalsubmissions@springernature.com

Malaria Journal

Contact us