Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Nucleotide sequence of haplotype clusters in Thiès

From: Temporal changes in Plasmodium falciparum reticulocyte binding protein homolog 2b (PfRh2b) in Senegal and The Gambia

Haplotype cluster Molecular barcodes N (%) N (isolats) PfRh2bdel (%) PfRh2bfull (%)
Haplotype cluster 36 CACTGCAGACCGCACCCAAGCCTG 0.345 2 100 0
Haplotype cluster 38 CACTCGAGATCGTCACCACGCTTG 0.345 2 0 100
Haplotype cluster 45 TATTCCGGTCCGTCCCCTCGCTTG 0.345 2 100 0
Haplotype cluster 51 TACTCCGGTTCGCACACACGACTG 0.345 2 100 0
Haplotype cluster 49 TATTCGAAATCGCACCCTAGATTG 0.345 2 100 0
Haplotype cluster 48 TACTCCAGTCCATACACACGATTG 0.345 2 100 0
Haplotype cluster 46 TACTGCAGATTGTACCCAAAACTG 0.345 2 50 50
Haplotype cluster 57 CACTGCGGATTGTACCTAAGACTG 0.345 2 50 50
Haplotype cluster 54 CGCTCCAGACTACACCCTAAACTG 0.345 2 0 100
Haplotype cluster 53 TACTCCGGATTGTCACCAAGACTG 0.345 2 100 0
Haplotype cluster 59 TACTCCGGTTTATACCTTAGACTG 0.345 2 0 100
Haplotype cluster 61 TACCGGAGTCCGTACCTAAGCCTG 0.345 2 0 100
Haplotype cluster 15 TACTCCGGTTCGTAAACTCGCCTG 0.345 2 50 50
Haplotype cluster 63 TACTCCAGACCGCCCCTAAAATTG 0.345 2 0 100
Haplotype cluster 9 TATTCCAGATXGCAACTTCGACTG 0.345 2 100 0
Haplotype cluster 62 TACTCGAGACTGCNCATACACTTG 0.345 2 0 100
Haplotype cluster 13 TACTCGAAACTXCCCATAAGCTTG 0.345 2 0 100
Haplotype cluster 68 TACCCCGGACCACCAATAAGACTG 0.345 2 0 100
Haplotype cluster 69 TACTGGGATCCGCACCTAAGACTG 0.345 2 0 100
Haplotype cluster 67 CACTCCGGATTGCCACTTAGATTG 0.345 2 50 50
Haplotype cluster 70 TATTCCGGACXACACACTAGCTTG 0.345 2 0 100
Haplotype cluster 22 TACTCCGGATCGCACCCTAGATTG 0.345 2 50 50
Haplotype cluster 74 TACTCCAGACTATCCATTCGATTG 0.345 2 50 50
Haplotype cluster 71 CACTCGGGATTXCCACTAAGCTTG 0.345 2 0 100
Haplotype cluster 80 CATTCCAGTCCXCCAATAAGATTG 0.345 2 0 100
Haplotype cluster 72 TATTGGGGATCGCAACCAAGATTG 0.345 2 100 0
Haplotype cluster 77 TACTGGAGTCCGTACCTTAGCTTG 0.345 2 50 50
Haplotype cluster 97 CACTCGAAATXATACCTTAGCTTG 0.345 2 50 50
Haplotype cluster 87 TACTCGGGTCTATAAATAAGACTG 0.345 2 0 100
Haplotype cluster 89 TACTCGAGTTTATACCTTAGACTG 0.345 2 0 100
Haplotype cluster 92 TATTGCAGTCCXCAAATAAGCTTG 0.345 2 0 100
Haplotype cluster 84 CACTCCAGTCCACCACNTAGATTG 0.345 2 100 0
Haplotype cluster 96 TATTCCAGACCGCACATTAGCCTG 0.345 2 50 50
Haplotype cluster 93 TACTCCAGTCCGTCACTTAGACTG 0.345 2 100 0
Haplotype cluster 44 TACTCCAGACTACAACTACGCCTG 0.345 2 0 100
Haplotype cluster 43 TATTCCAGATTGCAACTTCGCCTG 0.517 3 100 0
Haplotype cluster 58 CACTCGAGTTXACAACCTAGCCTG 0.517 3 33 67
Haplotype cluster 7 CACTCCGGATTGCCACTAAGATTG 0.517 3 33 67
Haplotype cluster 19 TATTCGAGTCTACACCTTCACTTG 0.517 3 100 0
Haplotype cluster 21 TACCCCGGTCCACCACTAAAATTG 0.517 3 0 100
Haplotype cluster 23 CACCCGAGTCCACCAACAAGACTG 0.517 3 0 100
Haplotype cluster 95 CACCCCGAATCXCACCTAAGACTG 0.517 3 0 100
Haplotype cluster 99 TACTCCGAACTGCACATTAGATTG 0.517 3 100 0
Haplotype cluster 55 TACTCCGGTTTGCACACACGACTG 0.69 4 100 0
Haplotype cluster 64 TACTCGAGATXATACATACACTTG 0.69 4 0 100
Haplotype cluster 10 CATTGCGATCTGCAACCTAAACTG 0.69 4 100 0
Haplotype cluster 24 CATTCCAGTCCXCCCATTAGATTG 0.69 4 25 75
Haplotype cluster 81 TACTCCAGATCGCACCCAAGCCTG 0.69 4 75 25
Haplotype cluster 98 CACTCGAGTTTACAACTAAGATTG 0.69 4 25 75
Haplotype cluster 5 TACTCGAAACTGCCCATAAGCTTG 0.69 4 0 100
Haplotype cluster 65 CACTCCAAATCGTACCTTAGATTG 0.862 5 100 0
Haplotype cluster 8 TACCCCGGTCCACACCTTAACTTG 0.862 5 100 0
Haplotype cluster 11 TACTCGAGATCATACATACACTTG 0.862 5 0 100
Haplotype cluster 12 CACTGCGATCTGCAACCTAAACTG 0.862 5 100 0
Haplotype cluster 6 CATTCCAGTCCGCCAATAAGATTG 1.034 6 0 100
Haplotype cluster 26 CACTCCAGTCCGTCACCAAGATTG 1.034 6 17 83
Haplotype cluster 17 TACCCCGGTCCACCAATAAGATTG 1.207 7 0 100
Haplotype cluster 16 TACTCCAGATTACAACCTAGCCTG 1.207 7 100 0
Haplotype cluster 66 TGTTCCAGTTTATCACCACGCCTG 1.379 8 12.50 87.50
Haplotype cluster 18 TATTCCAGTCCACCCATAAGACTG 1.552 9 89 11
Haplotype cluster 4 TACTCCGGTTXGCACACACGACTG 2.586 15 100 0
Haplotype cluster 29 TACCCCGGTCCACCAATAAGACTG 7.241 42 9.50 90.50
  UNIQUES 58.27 338 49.11 50.89
  1. N, number of isolates; PfRh2bdel, deletion present; PfRh2bfull, full-length sequence