Skip to main content

Table 1 Working concentrations and sources are provided for the qPCR primers and probes.

From: Use of a highly-sensitive rapid diagnostic test to screen for malaria in pregnancy in Indonesia

 Sequence 5′–3′Concentration (nM)Source
Pan reverse [25]AACCCAAAGACTTTGATTTCTCATAA200Eurofins
MAL FP [25]CCGACTAGGTGTTGGATGATAGAGTAAA50Eurofins
MAL probe [25]ATTO700-CTATCTAAAAGAAACACTCAT-MGBEDQ80Eurogentec
OVA FP [25]CCGACTAGGTTTTGGATGAAAGATTTTT50Eurofins
OVA Probe [25]Cy5-CGAAAGGAATTTTCTTATT-MGBEDQ80Eurogentec
FAL FP [24]ATTGCTTTTGAGAGGTTTTGTTACTTT400Eurofins
FAL RP [24]GCTGTAGTATTCAAACACAATGAACTCAA400Eurofins
FAL probe [24]FAM-CATAACAGACGGGTAGTCAT-MGBQ200Thermo
VIV FP [24]GCAACGCTTCTAGCTTAATCCAC400Eurofins
VIV RP [24]CAAGCCGAAGCAAAGAAAGTCC400Eurofins
VIV probe [24]VIC-ACTTTGTGCGCATTTTGCTA-MGBQ200Thermo