Skip to main content

Table 1 List of candidate genotyping microsatellite markers for Plasmodium malariae UG01

From: Polymorphic markers for identification of parasite population in Plasmodium malariae

S. no.LocusaPrimerPrimer sequenceTm (°C)Location
1Pm05_707ForwardbGGTAGAAGGAGCAACGGACA63.5Chromosome 5
ReverseCGCTCGGGTCATCGTTATTA61.3
2Pm06_506ForwardbTTGTGCGTATGCAACCTTTC57.6Chromosome 6
ReverseCAAAAGGGAAGGAGCACAAA57.0
3Pm07_429ForwardbTTCCTTTTCATCCTCTGCAA59.1Chromosome 7
ReverseCGAATGAGAGTAGTGCGGAAA62.8
4Pm09_801ForwardbTGACTTCGGTTAGAATATGTTTGC60.7Chromosome 9
ReverseTCACACTCCTTTCAATTTCTCA59.4
5Pm12_426ForwardbTTCGTGTTCTCGCTTTCCTC62.0Chromosome 12
ReverseGATCACTTCGCACGGGATAG61.9
6Pm13_110ForwardbTCAAGTGGAATAACCGCAAG60.0Chromosome 13
ReverseCAGACGAGGACTTTCATTTCG60.4
  1. aNovel microsatellite markers for Plasmodium malariae based on fragment analysis of PCR products (N = 37)
  2. bForward primers were labelled with 6-FAM for fragment analysis. Thermal cyclin profile: initial denaturation at 94 °C for 5 min, 40 cycles of 94 °C for 1 min, 58–63 °C for 1 min and 72 °C for 1 min, followed by a final extension at 72 °C for 5 min