Skip to main content

Table 2 Multiplex-RT-PCR-ELISA: primers and probes

From: Multiplex-RT-PCR-ELISA panel for detecting mosquito-borne pathogens: Plasmodium sp. preserved and eluted from dried blood spots on sample cards

  Family No Pathogens and prevalence Primer 5′-3′ sequence Concentration ( pm/µl) Literaturea
Arboviruses Flaviviridae 1 Dengue virus (DENV) [8, 42, 61, 62] C-prm D1 TCAATATGCTGAAACGCGAGAGAAACCG 5.5 [25]b,c
D2 TTGCACCAACAGTCAATGTCTTCAGGTTC 5.5
DENV-1d rTS1 (DEN-1) CCCGTAACACTTTGATCGCT 5.5
DENV-2d mTS2 (DEN-2) CGCCACAAGGGCCATGAACAGTTT 5.5
DENV-3d TS3 (DEN-3) TAACATCATCATGAGACAGAGC 5.5
DENV-4d rTS4 (DEN-4) TTCTCCCGTTCAGGATGTTC 5.5
2 West Nile virus (WNV) [63,64,65] WNV lancio F CAGACCACGCTACGGCG 5.5 [66]b
WNV lancio R CTAGGGCCGCGTGGG 5.5
WNV lancio P TCTGCGGAGAGTGCAGTCTGCGAT 10
3 Zika virus (ZIKV) [67, 68] ZVforw CAGCTGGCATCATGAAGAAYC 5.5 [70]b
ZVrev1 CACTTGTCCCATCTTCTTCTCC 5.5
ZVrev2 CACCTGTCCCATCTTTTTCTCC 5.5
ZVprobe CYGTTGTGGATGGAATAGTGG 10
4 Yellow Fever virus (YFV) [69,70,71] YFV-F GCACGGATGTAACAGACTGAAGA 5.5 [72]b
YFV-R CCAGGCCGAACCTGTCAT 5.5
YFV-probe CGACTGTGTGGTCCGGCCCTC 10
Togaviridae (Alphaviruses) [37] 5 Semliki Forest virus (SFV) [64] SFV-F ACAGACTGTCACTGAGCAG 5.5 [75]b
SFV-R AGCTCCACGTCATCATTGAG 5.5
SFV-probe GTGACCATCTACTGCAGAGA 10
6 O´nyong-nyong virus (ONNV) [74,75,76] ONNV-F GCAGGGAGGCCAGGACAGT 5.5 [79]b
ONNV-R GCCCCTTTTTCYTTGAGCCAGTA 5.5
ONNV-probe TGTATTGCTCCTGCCGCTGG 10
7 Chikungunya virus (CHIKV) [42, 76, 78, 79] ChikS TGATCCCGACTCAACCATCCT 5.5 [82]b
ChikAs GGCAAACGCAGTGGTACTTCCT 5.5
ChikP TCCGACATCATCCTCCTTGCTGGC 10
Bunyaviridae 8 Rift Valley fever virus (RVFV) [81, 82] RVF-F TGAAAATTCCTGAGACACATGG 5.5 [79]b
RVF-R ACTTCCTTGCATCATCTGATG 5.5
RVF-probe CACAAGTCCACACAGGCCCCTTACAT 10
Protozoa Malaria (Plasmodium sp.) 9 Plasmodium sp. (MAL) [83] Plasmo Plu3 F GCTCTTTCTTGATTTCTTGGATG 5.5 [26]b
Plasmo Plu3 R AGCAGGTTAAGATCTCGTTCG 5.5
Plasmo Plu3 P ATGGCCGTTTTTAGTTCGTG 10
P. falciparum [84] FAL-F CTTTTGAGAGGTTTTGTTACTTTGAGTAA 5.5 [51]e
FAL-R TATTCCATGCTGTAGTATTCAAACACAA 5.5
FAL-probe TGTTCATAACAGACGGGTAGTCATGATTGAGTTCA 10
P. vivax [85] VIV-F ACGCTTCTAGCTTAATCCACATAACT 5.5 [88]e
VIV-R ATTTACTCAAAGTAACAAGGACTTCCAAGC 5.5
VIVAX-probe TTCGTATCGACTTTGTGCGCATTTTGC 10
P. malariae [87, 88] Pm-1 AGTTAAGGGAGTGAAGACGATCAGA 5.5 [89]e
Pm-2 CAACCCAAAGACTTTGATTTCTCATAA 5.5
Pm-probe ATGAGTGTTTCTTTTAGATAGC 10
  1. aThe primers and probes listed were obtained from the literature cited
  2. bIncluded in the multiplex-RT-PCR-ELISA
  3. cUsed to type DENV1-4 according to the method of Chien et al. [25]
  4. dProbes for DENV1-4 consisted of the respective biotinylated primers
  5. eUsed to differentiate Plasmodium sp. by multiplex-RT-PCR-ELISA
\