Skip to main content

Table 1 Sequences of primers designed for P. vivax and P. falciparum

From: Multicopy targets for Plasmodium vivax and Plasmodium falciparum detection by colorimetric LAMP

Specie LAMP Target   Primers Sequence (5ʹ→3 ʹ )
P. vivax PvCOX1-LAMP COX1 F3 GAATAATTGCACAAGAAAATGTTAAC
B3 GCAACAGGAGATAAAGACATAAGTGA
FIP CAAGTTCTGGAGAACCACATAAAATTG– CCAGGATTATTTGGAGGATTCG
BIP GTCATTTTATCTACAGCAGCAGAATTT- TGGTGGATATAAAGTCCATCCAGT
Pvr47-LAMP Pvr47 F3 AACACCTCCCACCAATCA
B3 GTGAATTATCGAAGGCATAA
FIP TACGCGGAAAATCAGAACAATTCAT- GTGCCAATTTTTTTTTGCGG
BIP ATCTTTCGCTTATCCATTCATCGA-TAGTGACAAAACATAAACACAGC
P. falciparum PfEMP1-LAMP EMP1 F3 CCGACAAAACTTTCACCCAA
B3 CTGTTGTGTTGTTACCACTAGG
FIP GGTGTAACCACTATCAGTTCCACTA- AGTGGTAAATACAGAGGCAAAC
BIP TCCGAAAGTGAGTATGAAGAATTGG- ATGTTTTATATTTAGGACTACCTGG
Pfr364-LAMP Pfr364 F3 CACTAGGTACGCCAACAT
B3 ACCCACAATTTTGATTGAGATG
FIP GTAGACACCATATGGTACCACGTA- GGATGTGTCTATCATATAGTCCG
BIP TTGTACCCAATTTTCCCCTAGCA- GTGTGTGCAACATCATAATCATCA