Assay | Primers/Probes 5'–3' | Reaction protocol | Thermal cycle | PCR product |
---|---|---|---|---|
A. funestus Species ID | FUNUNIV_F: CCGATGCACACATTCTTGAGTGCCTA FUN _R: CTCGGGCATCGATGGGTTAATCATG VAN _R: AACTCTGTCGACTTGGTAGCCGAAC RIV_R: AATCAGGGTCGAACGGCTTGCCG PAR_R: GCCCTGCGGTCCCAAGCTAGATT RIVLIKE_R: CTCCCGTGGAGTGGGGGATC LEES_R: GACGGCATCATGGCGAGCAGC | KapaTaq [500 nM primers] 2.0 mM MgCl2 | 94 °C/4 min × 1 cycle (94 °C/30 s 58 °C/30 s, 72 °C/45 s) × 30 cycles; 72 °C/7 min × 1 cycle | 496 bp An. vaneedeni, 424 bp An. funestus, 346 bp, An. rivulorum, 241 bp An. rivulorum-like (West Africa), 176 bp An. parensis and 93 bp An. leesoni [run 10 μl sample] |
Kdr detection | F: GGMGAATGGATYGAATCMATGTGGGA R: GATGAACCRAAATTKGACAAAAGCAA 3' | KapaTaq [500 nM primers] | 94 °C/ 5 min, 94 °C/ 1 min, 50 °C/ 2 min, 72 °C/ 2 min (35 cycles), 72 °C/ 2 min | 200 bp |
CYP6P9a | F: 5′-TCCCGAAATACAGCCTTTCAG-3′, R: 5′-ATTGGTGCCATCGCTAGAAG | PCR: KapaTaq; 30 uL reaction [500 nM primers] | The 30 μl solution underwent a denaturing step at 95 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, 57 °C for 30 s and 72 °C for 1 min and 30 s, followed by a final extension step of 72 °C for 10 min | 450 bp [run 10 uL, keep the rest for digestion] |
Digestion: 20 uL final volume [10.0 uL PCR product; 1 uL from 10U TaqI; 2 uL TaqI buffer 10x; BSA up to 100 ug/mL; water up to 20 uL] | Digestion: Incubate at 65 °C for 2 h | Restriction digest was separated on 2.0% agarose gel. The Taq I enzyme cut the 450-bp fragment from the putative pyrethroid resistance haplotype into two fragments of 350 and100 bp | ||
N485I acetylcholinesterase1 detection | F: CATGCGATACTGGTCAAACTTTGC R: GCCATTCGGGAAATTCGCTACTA P (wt) HEX-CAAACCCCAACACGGC-MGB P (mut): FAM-CAAACCCCATCACGGC-MGB | The TaqMan reactions were performed in a 10 uL final volume containing 1 × TaqManunivesalmastermix (Applied Biosystems), 800 nM of each primer and 200 nM of each probe, | Cycling conditions were: 10 min at 95 °C, 40 cycles of 15 s at 92 °C and 1 min at 60 °C | N/A |
Plasmodium detection | F: GCTTAGTTACGATTAATAGGAGTAGCTTG R: GAAAATCTAAGAATTTCACCTCTGACA P: Falcip + (FAM-TCTGAATACGAATGTC-MGB) P: OVM + (HEX-CTGAATACAAATGCC-MGB') | The TaqMan reactions were performed in a 10 uL final volume containing 1 × TaqManunivesalmastermix (Applied Biosystems), 800 nM of each primer and 300 nM of each probe | Cycling conditions were: 10 min at 95 °C, 45 cycles of 15 s at 92 °C and 1 min at 60 °C | N/A |