Molecular surveillance of chloroquine resistance in Plasmodium vivax isolates from malaria cases in Yunnan Province of China using pvcrt-o gene polymorphisms

Table 1 The primer names and the sequences, target fragment lengths of PCR amplification for the pvcrt-o gene in P. vivax strains

Fragments	Primer names	Primer sequences (5′→3′)	Product length (bp)	Amplification interval
F1	Vcrt-o-PR-F1	TTTTTATTTCCTCACGTGCTAAGTG	2223	329,998–332,220
F1	Vcrt-o-1R1	TGAATGCGCCGACGTAATT	2223	329,998–332,220
F2	Vcrt-o-5F1	GTTATCATCGCGTTTATAGGTAATT	2139	331,778–333,916
F2	Vcrt-o-9R1	GGTGTAGGTCATGGTTGAGAAT	2139	331,778–333,916
F3	Vcrt-o-11F1	GCGACAATTTAATCACCAGCTT	1127	333,685–334,811
F3	Vcrt-o-11R1	TTGGCTCATGAGCGGGTTAG	1127	333,685–334,811

ISSN: 1475-2875