Skip to main content


We're creating a new version of this page. See preview

  • Research
  • Open Access

Survey of Plasmodium in the golden-headed lion tamarin (Leontopithecus chrysomelas) living in urban Atlantic forest in Rio de Janeiro, Brazil

  • 1, 2,
  • 3, 4, 5,
  • 1,
  • 1,
  • 6,
  • 3, 7,
  • 8 and
  • 9Email author
Malaria Journal201615:93

  • Received: 17 October 2015
  • Accepted: 9 February 2016
  • Published:



Communicating the presence of potential zoonotic pathogens such as Plasmodium spp. in wild animals is important for developing both animal and human health policies.


The translocation of an exotic and invasive population of Leontopithecus chrysomelas (golden-headed lion tamarins) required the screening of these animals for specific pathogens. This studies objective was to investigate Plasmodium spp. infection in the L. chrysomelas, both to know its prevalence in these animals in the local area and to minimize the risk of pathogens being translocated to the destination site. To investigate Plasmodium spp. infection, blood samples from 268 animals were assessed for the presence of Plasmodium spp. by genus-specific PCR and stained thick and thin blood smears were examined by light microscopy. Data of human malaria infection in the studied region was also assembled from SINAN (Diseases Information System Notification—Ministry of Health of Brazil).


Results from the PCR and microscopy were all negative and suggested that no L. chrysomelas was infected with Plasmodium spp. Analysis of SINAN data showed that malaria transmission is present among the human population in the studied region.


This study is the first to provide information on Plasmodium spp. infection in L. chrysomelas. Plasmodium spp. infection of this species is rare or absent though malaria parasites circulate in the region. In addition, there is minimal risk of translocating Plasmodium spp. infected animals to the destination site.


  • Plasmodium
  • Malaria
  • Leontopithecus chrysomelas
  • Translocation


Malaria is a disease caused by infection with Plasmodium spp. parasites. It causes significant morbidity and mortality with 143,415 confirmed cases in Brazil in 2014 [1]. As well as infecting humans, Plasmodium spp. also infect other animals including non-human primates.

In Brazil, there are two Plasmodium spp. regularly identified in non-human primate populations, Plasmodium brasilianum and Plasmodium simium [2]. Differently from the majority of other primate-infective Plasmodium, which tend to infect hosts within the same taxonomic family, P. brasilianum infects hosts from at least three families of primates [3], including the family Callitrichidae [2] to which Leontopithecus spp. belong [4].

According to some researchers, malaria can be considered a zoonosis [5]. In the case of P. brasilianum, humans can be infected when exposed to sporozoites or blood stage parasites from non-human primate infections and it is transmitted by mosquito vectors to which both non-human primates and humans are exposed. Plasmodium brasilianum and P. simium are genetically and morphologically very similar to human parasites Plasmodium malariae and Plasmodium vivax, respectively [68]. Additionally, the human parasite Plasmodium falciparum has also been documented in non-human primates in the Brazilian Amazon [9]. Recently, in the Venezuelan Amazon, 12 individuals were found to be infected with parasites that had identical 18S gene sequences to P. brasilianum that had been isolated from the spider monkey (Alouatta seniculus) [10]. Therefore, it is possible that non-human primates in Brazil are reservoirs for parasites that could infect humans.

The translocation of wild animals has been highlighted as an important factor in emerging infectious diseases of wild animals [11], which in turn can threaten the survival of endangered species [11]. There is a possibility in any translocation programme that the introduction of animals into a new geographical area will involve the risk of also introducing new pathogens [12, 13], and therefore there is a responsibility to take steps to minimize this risk.

Due to the presence of non-human primate Plasmodium spp. infections [14] and the Plasmodium spp. vectors [15] in the Atlantic forest as well as locally acquired Plasmodium spp. infections in humans in Rio de Janeiro state [16, 17] it was determined that non-human primates living in the Atlantic forest around Rio de Janeiro could be at risk of being infected with Plasmodium spp. parasites.

The translocation of an exotic invasive population of Leontopithecus chrysomelas (golden-headed lion tamarin) [18] living in the urban Atlantic forest in Niteroi, Rio de Janeiro state to their native area (Bahia State, Brazil) [19], required the screening of the L. chrysomelas animals for pathogens, including Plasmodium spp., according to a national ruling in Brazil (IN no 179/08) [20] and International recommendations [21]. The animals were being translocated due to the risk of competition and hybridization with the endemic and endangered [22] Leontopithecus rosalia (golden lion tamarin).

The primary outcome of the screening was to identify whether there was any risk of translocating Plasmodium spp. infected animals from the original site (Rio de Janeiro state) to the destination area (Bahia state) during the L. chrysomelas translocation program, where they may pose a risk to both translocated animals and the local animals (although there was no golden-lion tamarin in the release site, there are other primate species). Alternatively, in cases of zoonosis, potentially presenting a risk to the human population living in the area [11, 13, 23]. In addition, information on the presence of Plasmodium spp. parasites in these animals could provide important information on the likelihood of these animals being reservoirs of parasites that could cause human disease. A small survey of Plasmodium spp. has already been conducted for L. rosalia with negative results (reviewed in [2]), however, this is the first work investigation involving L. chrysomelas.


Animals and capture

Three hundred and thirty-five Leontopithecus chrysomelas, Family Callitrichidae, were captured in an urban Atlantic forest fragment in the municipality of Niterói (Serra da Tiririca State Park, 22°56′S, 43°00′W) in the state of Rio de Janeiro, Brazil (Fig. 1) between June 2012 and November 2013. Their capture was part of a programme (the Tamarins Translocation Project) to remove L. chrysomelas from the range of L. rosalia and to translocate this invasive L. chrysomelas population to their natural area of occurrence in another state of Brazil (Bahia). No animals suffered, died naturally or were euthanized for the purpose of, or during the course of this research.
Fig. 1
Fig. 1

Map of Rio de Janeiro State. Serra da Tiririca State Park, where the animals were captured, is marked in black. The surrounding municipalities of interest are coloured in different shades of grey depending on the number of human malaria infections that occurred in each municipality between 2001 and 2014

Quarantine, anesthesia and sample collection

After capture, animals were kept in quarantine for 30 days at the Rio de Janeiro Primatology Centre (CPRJ/INEA) in Guapimirim (22°32′S, 42°59′W) before being translocated to Bahia state. During quarantine, the animals were kept in a quiet place, away from human contact, in large and modular cages. The size of the cages varied according to the number of animals per group and dividers for visual separation between the groups were used. In each cage, there were tree trunks for the animals to move around, and wooden housing for the animals to sleep or hide in (mimicking the behaviour of the species in the wild). Protective measures were taken to prevent excessive exposure to heat including water diffusers on the ceiling of the room and air conditioners inside the building. The animals received water ad libitum and food (fruits, vegetables, chow primates, eggs, mealworms) two times a day. All measures to avoid stress and to ensure the well-being were applied and this also helped with the translocation process. To collect blood, chemical restraint was performed using 8–10 mg/kg of ketamine (CETAMIN®, Syntec) with 0.25 mg/kg midazolam hydrochloride (Dormium®, União Química) in order to conduct a clinical evaluation which included venous blood sampling and noting the animals age and sex.

Processing and analysis of samples for Plasmodium spp

Thick and thin blood smears of venous blood were made and stained with Giemsa, using standard methods [24] and examined under 1000× light microscopy. One to two hundred µl of packed red blood cells were stored at −20 °C. Within 3 weeks of collection, DNA was extracted from the packed red blood cells using the Illustra™ blood genomicPrep Mini Spin kit (GE Healthcare) following the manufacturer’s instructions and genus specific nested PCR (first reaction rPLU1: 5′ tcaaagattaagccatgcaagtga 3′ and rPLU6: 5′ cgttttaactgcaacaattttaa 3′; second reaction PLU3: 5′ tttttataaggataactacggaaaagctgt 3′ and rPLU4: 5′ tacccgtcatagccatgttaggccaatacc 3′ was carried out according to previously described protocols [25, 26], in order to detect the presence of Plasmodium spp. DNA. Further, 10 % of samples from adults were randomly selected and re-tested by using Plasmodium ssrRNA primers rPLU6 5′ ttaaaattgttgcagttaaaacg 3′ and rPLU5 5′ cctgttgttgccttaaacttc 3′, as defined by Snounou et al. [27]. A blood sample from an individual known to be infected with Plasmodium was run as positive control in each PCR reaction. The DNA was extracted in the same way for the control as for the samples.

Obtaining information of local infections

Data on Plasmodium spp. infections in humans in Rio de Janeiro state during the period 2001–2014 were obtained from the Ministry of Health of Brazil—Diseases Information System Notification (Sistema de Informação de Agravos de Notificação—SINAN)—website [28]. The area of interest was defined as Rio de Janeiro State and then within Rio de Janeiro State the municipalities around the Tiririca State Park (Rio de Janeiro, Duque de Caxias, Magé, Guapimirin, Itaboraí, São Gonçalo, Niterói, and Maricá) (Fig. 1).


All procedures were approved by the Ethical Principles in Animal Research of the School of Veterinary Medicine and Animal Sciences, University of São Paulo (Protocol number no 2662/2012 issued on 15/08/2012) and were in full compliance with federal permits issued by the Brazilian Ministry of the Environment (SISBIO no 30939-5 issued on 18/08/2012).


Three hundred and thirty-five animals from 56 groups were captured; most groups were between 4 and 8 animals in size. Of the 335 animals, 268 animals (127 male, 116 female, 25 of unknown sex, including 24 infants) were tested for Plasmodium spp. and had results for all three samples (thick and thin smears and PCR of peripheral blood); some animals were not sampled due to body size (see Fig. 2). No Plasmodium spp. were visible in any of the smears and none of the blood samples from the animals contained DNA that was amplified by Plasmodium spp. specific primers.
Fig. 2
Fig. 2

Flow chart of animals captured and tested for infection with Plasmodium spp. between 2012 and 2013. *Animals weighing less than 300 g were not sampled. **Nine animals not tested for Plasmodium as they were not to be translocated to Bahia. ***Three PCRs, 5 thin smears and 10 thick smears from 17 animals did not give results due to bad quality or lost samples

According to SINAN from the Brazilian Ministry of Health [28] the number of human malaria cases has increased each year in Rio de Janeiro state, with 945 cases of Plasmodium spp. infections reported in the state between 2001 and 2012, including 200 cases from 2012. Between 2013 and 2014, 141 new cases of Plasmodium spp. infection were reported in the state [28]. Moreover, reported cases from the municipalities near to the Serra da Tiririca State Park, comprise of malaria infections of residents or non-residents that were acquired elsewhere and from residents or non-residents that were acquired in the region (Fig. 1; Table 1).
Table 1

Plasmodium infections in humansa between 2001 and 2014 reported in the area of interest of Rio de Janeiro Stateb, according to the—Diseases Information System Notification (SINAN) from Brazilian Ministry of Health


P. falciparum

P. vivax

P. falciparum + P. vivax


Imported cases





Autochthonous cases





Reported casesa





aIncludes infections that were reported (imported and autochthonous cases) within the municipalities nearby the park, infections could occur in residents (see in Fig. 1) or non-residents

bThe area of interest are the municipalities Rio de Janeiro, Duque de Caxias, Magé, Guapimirin, Itaboraí, São Gonçalo, Niterói, and Maricá* near the Serra da Tiririca State Park (see in Fig. 1)


This study describes the screening of a large wild non-human primate population (L. chrysomelas) for Plasmodium spp. None of the animals were infected. Results agree with previous work, which found Plasmodium spp. infection absent in other tested animals of the genus (L. rosalia), and only very low frequency infection of family Callitrichidae, even in areas where infection in other species was common [2, 9, 25, 29, 30]. For example, infection of the family Callitrichidae with Plasmodium spp. has been found in only four animals out of 604 Callitrichidae animals tested in Brazil between 1937 and 2013 [2, 9, 25, 29, 30] with the parasite being identified as P. brasilianum. In addition two species Callithrix penicillata, and Callithrix jacchus that were also introduced in Rio de Janeiro, and can be observed in the same area as the introduced L. chrysomelas [31], have also been surveyed for Plasmodium spp. infection (at other geographical locations) by light microscopy and like the L. chrysomelas were negative for infection [2].

Parasites do not randomly infect hosts, it is unlikely that any Plasmodium spp. infects all available primates, although it is still unclear which Plasmodium spp. can infect which species of primates. Plasmodium brasilianum has been shown to be able to infect a wide variety of non-human primates (reviewed in [3]), but L. chrysomelas may not be susceptible to infection. This could be because their position in the canopy, sleeping in hollows of trees from dusk to sunrise [32], when Anopheles are more active, and their small body size may result in low vector exposure (reviewed in [33]). Alternatively, L. chrysomelas may not provide an environment suitable for parasite survival [3]. It is also possible that the negative results are due to a low frequency of Plasmodium spp. in the area.

It is unlikely that this work contains false negative results as the negative results were due to agreement between both the microscopy results of thin and thick smear slides as well the as genus specific PCR, furthermore, the results were further confirmed with a different set of PCR primers in 10 % of randomly selected samples.

Though this study agrees with findings in the literature, which shows animals from the same genus or even from the same family are often negative for infection [2, 9, 25, 29, 30], it is still possible that other non-human primates in the area are infected with Plasmodium spp. Data from the website SINAN showed that endemic infections in areas around the park do occur (Table 1) and interestingly Anopheles aqualasis, an efficient transmitter of Plasmodium spp., has been identified specifically in the same area where the L. chrysomelas were captured [34]. In addition, other studies in the Atlantic forest have reported Plasmodium spp. infections in vectors [15] and non-human primates [14], including in 30 % of tested non-human primates living in and around the Rio de Janeiro Primatology Center (CPRJ/INEA) in Guapimirim [35] which is located the same area of this study.

Leontopithecus chrysomelas in Rio de Janeiro often live in high-risk interfaces, in close proximity with humans occasionally accessing backyards or housing, which could increase the risk of transmission, especially when human residents are infected with Plasmodium. In addition, if they were infected with Plasmodium, this proximity would identify them as possible reservoirs for Plasmodium spp. which may in turn infect the local population; however these results suggest that this is unlikely to occur.

With the translocation of the animals, there was the responsibility to ensure that this action would not also result in the transfer of pathogens to potentially susceptible wild animals and/or the local human population. The results from this work show that there is a minimum risk of transfer of Plasmodium spp. to Bahia state. However, establishing the risk factors for emerging infectious diseases is challenging and even the introduction of disease-free animals into an area could pose a threat as it has the potential to alter variables like population density [11], therefore, any translocation programme needs to be thoroughly thought through.

Much research still needs to be done in the field of Plasmodium in non-human primates. The evolutionary history of P. brasilianum and P. simium is unclear (primarily due to a lack of primate samples [7]). However, data suggests that the transfer from humans to non-human primates (or vice versa) was recent and in the case of P. brasilianum has occurred more than once [7]. Also, though P. brasilianum can infect humans in an experimental setting [5], it is still unclear if it is likely to pose a risk to humans. As many countries strive to eliminate malaria, whether species such as P. brasilianum and P. simium can be readily transmitted between non-human primates to human populations needs to be clarified. In addition, any animal population likely to be a reservoir needs to be identified.


This study is the first to provide information about Plasmodium spp. infection in a population of L. chrysomelas of the urban Atlantic forest of Rio de Janeiro state. The results indicate that Plasmodium spp. infection in L. chrysomelas population, from Serra da Tiririca Park, is rare or absent despite malaria parasites circulating in the region among vectors, humans and other non-human primates. The absence of infection provides no evidence to support that this species is a reservoir for parasites infecting humans and also suggests that the translocation of the tested animals exhibits a minimal risk of translocating Plasmodium spp. infected animals to Bahia state. In addition, this study promotes knowledge about Plasmodium parasites in the same areas that endangered species inhabit, such as Leontopithecus rosalia, which could represent a further threat for these tamarins and other primates.



Sistema de Informação de Agravos de Notificação website


Authors’ contributions

EHA carried out the genus-specific PCR, examined thick and thin smears by light microscopy and drafted the paper; MGB and AP collected the samples and clinical information of the animals, helped analyse the results and draft the manuscript; LSO helped carry out the genus specific PCR; MCMK helped collect the samples and draft the manuscript. JMA helped draft the manuscript. JLCD conceived the study and helped draft the manuscript. SE conceived the study, carried out the epidemiological analysis from the SINAN website and drafted the manuscript. All authors read and approved the final manuscript.


We would like to thank the Pri-Matas team and to CPRJ-INEA for their support during this research, as well as the Instituto Estadual do Ambiente (INEA-RJ) and the Centro de Primatas Brasileiros do Instituto Chico Mendes para a Conservação da Biodiversidade (CPB-ICMBio) for their support. We would also like to thank all the institutions and organisations which provided financial support for the Tamarins Translocation Project including the Fundação Grupo O Boticário, the Lion Tamarin of Brazil Fund, the Primate Action Fund, the Margot Marsh Foundation, The Mohamed bin Zayed Species Conservation Fund, RBO Energia S.A. (Câmara de Compensação Ambiental/Secretaria do Meio Ambiente Rio de Janeiro), the Tropical Forest Conservation Act/Fundo Brasileiro para Biodiversidade (TFCA/FUNBIO)—Rio de Janeiro, and the Instituto Pri-Matas para Conservação da Biodiversidade. Laboratory tests were done with grants from São Paulo Research Foundation (FAPESP) (2009/51466-4, 2009/53561-4 and 2009/53256-7) awarded to JLCD and SE. MCMK was supported by PNPD/CAPES. EHA was supported by a FAPESP fellowship (2011/19525-0). SE and JLCD were supported by Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) (306668/2012-2) and (301517/2006-1) respectively. In addition, we are grateful to Jefferson Ferreira–Ferreira (Instituto de Desenvolvimento Sustentável Mamirauá—IDSM/MCTI) for creating the map in Fig. 1.

Competing interests

The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

Departamento de Imunologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, São Paulo, Brazil
Present address: Department of Medicine, Peter Doherty Institute, University of Melbourne, Melbourne, Victoria, Australia
Instituto Pri-Matas para Conservação da Biodiversidade (Pri-Matas), Rio de Janeiro, Brazil
Instituto de Desenvolvimento Sustentável Mamirauá (IDSM/MCTI), Tefé, Amazonas, Brazil
Present address: Fundação Oswaldo Cruz, Programa Institucional Biodiversidade & Saúde, Rio de Janeiro, Brazil
Centro de Primatologia (CPRJ/INEA), Rio de Janeiro, Brazil
Programa de Pós-Graduação em Biodiversidade Tropical, Centro Universitário Norte do Espírito Santo, Universidade Federal do Espírito Santo, São Mateus, Brazil
Laboratório de Patologia Comparada de Animais Selvagens (LAPCOM), Departamento de Patologia, Faculdade de Medicina Veterinária e Zootecnia, Universidade de São Paulo, São Paulo, São Paulo, Brazil
Departamento de Análises Clínicas e Toxicológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Av. Prof. Lineu Prestes, 580, Butantã, São Paulo, 05508-000, Brazil


  1. WHO. World malaria report. Geneva: World Health Organization; 2015.Google Scholar
  2. Deane LM. Simian malaria in Brazil. Mem Inst Oswaldo Cruz. 1992;87(Suppl 3):1–20.View ArticlePubMedGoogle Scholar
  3. Garamszegi LZ. Patterns of co-speciation and host switching in primate malaria parasites. Malar J. 2009;8:110.PubMed CentralView ArticlePubMedGoogle Scholar
  4. Paglia AP, da Fonseca GAB, Rylands AB, Herrmann G, Aguiar LMS, Chiarello AG, Leite YLR, Costa LP, Siciliano S, Kierulff MCM, Mendes SL, da Tavares VC, Mittermeier RA, Patton JL. Lista Anotada dos Mamíferos do Brasil/Annotated checklist of Brazilian Mammals. 2a Edição/2nd Edition. Occasional papers in conservation biology. vol. 6. Arlington, VA: Conservation International; 2012.Google Scholar
  5. Baird JK. Malaria zoonoses. Travel Med Infect Dis. 2009;7:269–77.View ArticlePubMedGoogle Scholar
  6. Yamasaki T, Duarte AM, Curado I, Summa ME, Neves DV, Wunderlich G, et al. Detection of etiological agents of malaria in howler monkeys from Atlantic Forests, rescued in regions of Sao Paulo city, Brazil. J Med Primatol. 2011;40:392–400.View ArticlePubMedGoogle Scholar
  7. Tazi L, Ayala FJ. Unresolved direction of host transfer of Plasmodium vivax v. P. simium and P. malariae v. P. brasilianum. Infect Genet Evol. 2011;11:209–21.View ArticlePubMedGoogle Scholar
  8. Fandeur T, Volney B, Peneau C, de Thoisy B. Monkeys of the rainforest in French Guiana are natural reservoirs for P. brasilianum/P. malariae malaria. Parasitology. 2000;120:11–21.View ArticlePubMedGoogle Scholar
  9. Araujo MS, Messias MR, Figueiro MR, Gil LH, Probst CM, Vidal NM, et al. Natural Plasmodium infection in monkeys in the state of Rondonia (Brazilian Western Amazon). Malar J. 2013;12:180.PubMed CentralView ArticlePubMedGoogle Scholar
  10. Lalremruata A, Magris M, Vivas-Martinez S, Koehler M, Esen M, Kempaiah P, et al. Natural infection of Plasmodium brasilianum in humans: man and monkey share quartan malaria parasites in the Venezuelan Amazon. EBioMedicine. 2015;2:1186–92.PubMed CentralView ArticlePubMedGoogle Scholar
  11. Daszak P, Cunningham AA, Hyatt AD. Emerging infectious diseases of wildlife–threats to biodiversity and human health. Science. 2000;287:443–9.View ArticlePubMedGoogle Scholar
  12. Cunningham AA. Disease risks of wildlife translocations. Conserv Biol. 1996;10:349–53.View ArticleGoogle Scholar
  13. Kock RA, Woodford MH, Rossiter PB. Disease risks associated with the translocation of wildlife. Rev Sci Tech. 2010;29:329–50.PubMedGoogle Scholar
  14. Neves A, Urbinatti PR, dos Malafronte SR, Fernandes A, da Silva Paganini W, Natal D. Malaria outside the Amazon region: natural Plasmodium infection in anophelines collected near an indigenous village in the Vale do Rio Branco, Itanhaem, SP, Brazil. Acta Trop. 2013;125:102–6.View ArticlePubMedGoogle Scholar
  15. Duarte AM, Pereira DM, de Paula MB, Fernandes A, Urbinatti PR, Ribeiro AF, et al. Natural infection in anopheline species and its implications for autochthonous malaria in the Atlantic Forest in Brazil. Parasit Vectors. 2013;6:58.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Lorenz C, Virginio F, Aguiar BS, Suesdek L, Chiaravalloti-Neto F. Spatial and temporal epidemiology of malaria in extra-Amazonian regions of Brazil. Malar J. 2015;14:408.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Miguel RB, Peiter PC, de Albuquerque H, Coura JR, Moza PG, Costa Ade P, et al. Malaria in the state of Rio de Janeiro, Brazil, an Atlantic Forest area: an assessment using the health surveillance service. Mem Inst Oswaldo Cruz. 2014;109:634–40.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Leontopithecus chrysomelas.
  19. Pinto LPD, Rylands AB. Geographic distribution of the golden-headed lion tamarin, Leontopithecus chrysomelas: implications for its management and conservation. Folia Primatol. 1997;68:161–80.View ArticleGoogle Scholar
  20. Renováveis PdIBdMAedRN: Ruling No. 179 In. Edited by Resources IBdMAedRNRBIoEaRN, vol. 179., Diário Oficial daUnião, Brasília 2008.
  21. UCN/SSC. Guidelines for reintroductions and other conservation translocations, vol. viiii. Gland, Switzerland: IUCN Species Survival Comission; 2013.Google Scholar
  22. Leontopithecus rosalia.
  23. Deem SL, Karesh WB, Weisman W. Putting theory into practice: wildlife health in conservation. Conserv Biol. 2001;15:1224–33.View ArticleGoogle Scholar
  24. Ministério da Saúde. Manual de Diagnóstico Laboratorial da Malária. Brazil: Ministério da Saúde; 2005.Google Scholar
  25. Bueno MG, Rohe F, Kirchgatter K, Di Santi SM, Guimaraes LO, Witte CL, et al. Survey of Plasmodium spp. in free-ranging neotropical primates from the Brazilian Amazon region impacted by anthropogenic actions. EcoHealth. 2013;10:48–53.View ArticlePubMedGoogle Scholar
  26. dos Santos LC, Curotto SMR, de Moraes W, Cubas ZS, Costa-Nascirnento MD, de Barros IR, et al. Detection of Plasmodium sp. in capybara. Vet Parasitol. 2009;163:148–51.View ArticlePubMedGoogle Scholar
  27. Snounou G, Viriyakosol S, Zhu XP, Jarra W, Pinheiro L, do Rosario VE, et al. High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol Biochem Parasitol. 1993;61:315–20.View ArticlePubMedGoogle Scholar
  28. Sistema de Informação de Agravos de Notificação.
  29. Duarte AM, dos Santos Malafronte R, Cerutti C Jr, Curado I, de Paiva BR, Maeda AY, et al. Natural Plasmodium infections in Brazilian wild monkeys: reservoirs for human infections? Acta Trop. 2008;107:179–85.View ArticlePubMedGoogle Scholar
  30. Lourenco-de-Oliveira R, Deane LM. Simian malaria at two sites in the Brazilian Amazon. I-The infection rates of Plasmodium brasilianum in non-human primates. Mem Inst Oswaldo Cruz. 1995;90:331–9.View ArticlePubMedGoogle Scholar
  31. Oliveira LC, Grelle CEV. Introduced primate species of an Atlantic Forest region in Brazil: present and future implications for the native fauna. Trop Conserv Sci. 2012;5:112–20.Google Scholar
  32. Rosenberger AL. Marmosets and tamarins: systematics, behavior, and ecology. New York: Oxford University Press; 1993.Google Scholar
  33. de Thoisy B, Vogel I, Reynes JM, Pouliquen JF, Carme B, Kazanji M, et al. Health evaluation of translocated free-ranging primates in French Guiana. Am J Primatol. 2001;54:1–16.View ArticlePubMedGoogle Scholar
  34. Souza AS, Oliveira SJ, Couri MS. Mosquitos (Diptera, Culicidae) das regiões de Pendotiba e oceânica de Niterói (Rio de Janeiro, Brasil). Rev Bras Zool. 2001;18:557–81.View ArticleGoogle Scholar
  35. de Alvarenga DA, de Pina-Costa A, de Sousa TN, Pissinatti A, Zalis MG, Suarez-Mutis MC, et al. Simian malaria in the Brazilian Atlantic forest: first description of natural infection of capuchin monkeys (Cebinae subfamily) by Plasmodium simium. Malar J. 2015;14:81.PubMed CentralView ArticlePubMedGoogle Scholar


© Aitken et al. 2016


By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate. Please note that comments may be removed without notice if they are flagged by another user or do not comply with our community guidelines.
