Open Access

An intricate case of multidrug resistant Plasmodium falciparum isolate imported from Cambodia

  • Raffaele Dell’Acqua1Email authorView ORCID ID profile,
  • Claudia Fabrizio1,
  • Francesco Di Gennaro1,
  • Sergio Lo Caputo1,
  • Annalisa Saracino1,
  • Michela Menegon2,
  • Mariangela L’Episcopia2,
  • Carlo Severini2,
  • Laura Monno1,
  • Francesco Castelli3 and
  • Gioacchino Angarano1
Malaria Journal201716:149

Received: 21 February 2017

Accepted: 1 April 2017

Published: 14 April 2017



Imported cases of multidrug resistant Plasmodium falciparum and treatment failure with artemisinin-based regimens, although rare, have been described also in Western countries and their management is often challenging. This is also due to an inadequate knowledge and implementation of health prevention measures.

Case report

A complex case of imported malaria caused by Plasmodium vivax/P. falciparum isolates in a patient who was not taking chemoprophylaxis while he was travelling in Cambodia is reported in this article. After failures of artemisinin-based and both oral and intravenous quinine-based regimens, a multidrug resistant P. falciparum was detected. The patient was successfully treated with atovaquone–proguanil.


This experience highlights the importance of a careful management that should be based not only on the most up-to-date guidelines, but also on the awareness of a rapidly evolving scenario.


Malaria, Vivax Malaria, Falciparum Malaria Drug resistance Multiple Antimalarials Genes, MDR Travel medicine Cambodia


Imported cases of multidrug resistant (MDR) Plasmodium falciparum and treatment failure with artemisinin-based regimens, although rare, have been described also in Western countries and their management is often challenging [1, 2]. Even if uncommon, the possibility of imported infections by drug-resistant Plasmodium spp. should be considered, especially in travellers returning from highly endemic regions [3], where the most recent first-line artemisinin-based regimens are losing their effectiveness, also due to selective drug pressure [4, 5]. Moreover, the increasing accessibility to remote geographic areas of the world by do-it-yourself travellers not always keeps the pace with an adequate knowledge and implementation of health prevention measures. The following case illustrates these issues.

Case presentation

A 27-years old male Italian patient, carrying thalassemia trait, returned on November 22nd, 2015 from a 4-week long pleasure trip to Cambodia, without taking any malaria chemoprophylaxis. This trip also included a 5-days trekking throughout the Pursat region. The day before his return, he had a rapid onset of fever up to 39 °C preceded by chills, cough and diarrhoea. Due to the persistence of fever despite therapy with ciprofloxacin and paracetamol, he was admitted to the Clinic of Infectious Diseases, Policlinico Hospital, Bari, on November 25th. Upon admission he had dehydration, mild leucocytosis (white blood cells 11.36 × 109/L), haemoglobin (Hb) 13.3 g/dL, platelets (PLTs) 62 × 109/L, C-reactive protein (CRP) 64.8 mg/L. On suspicion of malaria, peripheral blood smears and molecular biology testing (multiplex Real-Time PCR, Fast-Track Diagnostic) were performed, proving to be positive for P. falciparum and Plasmodium vivax, with a parasitaemia below 2%. A 3-day dihydroartemisinin–piperaquine regimen was initiated, with rapid defervescence and good clinical progress. After the end of treatment, blood smears resulted negative and the patient was discharged with prescription of 30 mg/day of primaquine for 14 days for radical cure.

On December 1th he was readmitted due to the reappearance of fever in the previous 2 days. Primaquine treatment had not been initiated due to delayed supply of the drug which is not readily available in Italy. Laboratory data showed anaemia (Hb 7.3 g/dL, requiring blood transfusion even in the absence of symptoms), thrombocytopaenia (PLTs 84 × 109/L) and CRP elevation (40 mg/L). Peripheral blood smears were again positive for P. falciparum trophozoites; P. vivax gametocytes were also detected, as an expected biologic evolution without pathologic significance. This finding is consistent with missed start of primaquine. Therefore, a second-line therapy with oral quinine and doxycycline was started. A prompt clinical improvement was observed after 24 h; a 7-day course of therapy was completed leading to negative blood smears. Primaquine administration was withheld until the resolution of P. falciparum recrudescence and it was started on December 23rd shortly before hospital discharge. Indeed the patient was dismissed on December 24th with indication to complete a full 14-days course with weekly monitoring of complete blood count.

However, on January 18th the patient presented with fever and diarrhoea. After a few days of symptomatic home treatment with temporary benefit, he was readmitted showing thrombocytopaenia (PLTs 110 × 109/L), anaemia (Hb 9.2 g/dL) and CRP elevation (40.3 mg/L). Plasmodium falciparum trophozoites were detected on blood smears and therapy was initiated with intravenous quinine (loading dose of 20 mg/kg, followed by maintenance dose of 10 mg/kg q8h for 7 days) at first and, subsequently, with atovaquone/proguanil, thus obtaining the definitive clearance of the parasite and healing.

The resistance of the Plasmodium falciparum isolate infecting this patient to anti-malarial drugs was assessed by the evaluation of single nucleotide polymorphisms (SNPs) of six molecular gene markers (PfK13, Pfcrt, Pfmdr1, Pfdhfr, Pfdhps and PfCytB) linked to resistance to artemisinin derivatives, quinolines, antifolates–cycloguanil and atovaquone.

Total DNA was extracted (PureLink Genomic DNA Kits-Invitrogen) from 200 µL of three patient’s blood specimens collected on November 26th, 2015 (first hospital admission), December 15th, 2015 (second admission) and January 29th, 2016 (third admission). The polymorphism of the P. falciparum K13-propeller gene, from codon 427 to codon 690, was assessed using the primers: ArtinnerF (GCCTTGTTGAAAGAAGCAGAA) and ArtouterR (CGCCATTTTCTCCTCCTGTA) and with PCR conditions described by Taylor et al. [6]. Analysis of Pfcrt and Pfmdr1 genes was performed as previously reported [7, 8]. Different methods were used for the analysis of fragment of Pfdhfr gene spanning codons 51–108, Pfdhps domain (719 bp) and point mutation in PfCytB gene, according to Palmieri et al. [9], Menegon et al. [7] and Korsinczky et al. [10], respectively. All PCR products were sent to Eurofins Genomics Company (Germany) for sequencing, and sequences were compiled and analysed by Accelrys DS Gene software.

Analysis of polymorphisms of P. falciparum isolates showed a pattern of multidrug resistance due to the presence of point mutations associated with quinoline (including amodiaquine), drug resistance in Pfcrt and Pfmdr1, and mutations correlated to sulfadoxine/pyrimethamine resistance in Pfdhps and Pfdhfr genes (Table 1). In particular, in the Pfk13 gene was observed the presence of the mutation C580Y, which is an important determinant of artemisinin resistance in P. falciparum population circulating in Southeast Asia [11, 12]. The absence of mutations at codons 258 and 268 of CytB gene indicated a sensitivity of the P. falciparum isolate to atovaquone and is consistent with the good response of the patient to atovaquone/proguanil administration.
Table 1

Analysis of polymorphisms of the P. falciparum isolates

Pfcrt and Pfmdr1 genes point mutations are associated with quinoline (including amodiaquine) drug resistance; Pfdhfr and Pfdhps genes mutations are responsible for P. falciparum resistance to antifolate-cycloguanil; Pfk13 gene mutation C580Y is considered an important determinant of artemisinin resistance

Mutant codons from the three different samples are in blue


This report shows the serious consequences, both in terms of clinical impact and health-related expenses, of a rare and extended resistance pattern of P. falciparum strain. Indeed, the management of this patient was complex; firstly, because he experienced three subsequent admissions, resulting in a prolonged hospitalization. Furthermore, once malaria recrudescence was confirmed, pharmacological treatment was cumbersome in terms of drug supply, costs, safety profile and consequent need of strict monitoring. An additional issue was represented by molecular analysis, which required the expertise of the Italian National Institute of Health (ISS) since these assays are not routinely available. Lastly, patient’s anxiety regarding the course of the disease should also be taken into account.

A double recrudescence of P. falciparum in the same patient is a rare event to observe. Moreover, the chance of a recrudescence after a second-line treatment of oral quinine plus doxycycline is very low [13]. Reasons for failure with this regimen may include a decrease in the sensitivity or an inadequate exposure to the drug caused by unusual pharmacokinetics in an individual, scarce adherence to the prescribed regimen or poor quality of anti-malarial drugs [14]. In this case, therefore, the concurrence of both pathogen- and host-related factors could have been responsible for the second recrudescence.

Based on the multidrug resistance pattern of P. falciparum, a complicated clinical course could have been expected. However, with the exception of a single blood transfusion, the patient did not require any extraordinary therapeutic measure. Thalassaemia trait probably played a relevant role in attenuating the severity of the disease, whereas the clinical impact of dual infection was unclear, based on the heterogeneous results of several studies regarding the mutual interactions between the two Plasmodium species and the role of immunity [15].

As Cambodia is known to be the cradle of anti-malarial drug resistance, patients returning from this area should be considered at risk for failure of artemisinin-based regimens [16]. Therefore, according to our experience, even the most up-to-date guidelines should be handled with care in this rapidly evolving scenario and to this regard, the atovaquone/proguanil combination may be considered as a valuable therapeutic option in some special cases [17].

In a context of increasing international travel and trades in which exotic regions are easier to reach, the relevance of a proper prophylaxis should be highlighted in order to obtain individual protection. Moreover, in this framework, an increased awareness about the possibility to manage such difficult cases also in non-endemic settings should become a matter of utmost importance.



multidrug resistant






C-reactive protein


single nucleotide polymorphisms


Istituto Superiore di Sanità


Authors’ contributions

RDA, CF, CS and SLC drafted the manuscript. FDG and AS collected clinical and laboratory data. MM, MLE and CS performed the molecular tests. LM, FC and GA revised the paper critically. All authors read and approved the final manuscript.



Competing interests

The authors declare that they have no competing interests.

Consent for publication

Written informed consent for the publication of the present case was obtained from the patient.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

Clinic of Infectious Diseases, Università degli Studi di Bari Aldo Moro
Department of Infectious Diseases, Istituto Superiore di Sanità
University Department of Infectious and Tropical Diseases, Azienda Ospedaliera Spedali Civili di Brescia


  1. Gobbi F, Buonfrate D, Menegon M, Lunardi G, Angheben A, Severini C, et al. Failure of dihydroartemisinin–piperaquine treatment of uncomplicated Plasmodium falciparum malaria in a traveller coming from Ethiopia. Malar J. 2016;15:525.View ArticlePubMedPubMed CentralGoogle Scholar
  2. Sondén K, Wyss K, Jovel I, da Silva AV, Pohanka A, Asghar M, et al. High rate of treatment failures in non-immune travelers treated with artemether–lumefantrine for uncomplicated Plasmodium falciparum malaria in Sweden: retrospective comparative analysis of effectiveness and case series. Clin Infect Dis. 2017;64:199–206.View ArticlePubMedGoogle Scholar
  3. Ashley EA, Dhorda M, Fairhurst RM, Amaratunga C, Lim P, Suon S, et al. Spread of artemisinin resistance in Plasmodium falciparum malaria. N Engl J Med. 2014;371:411–23.View ArticlePubMedPubMed CentralGoogle Scholar
  4. WHO. Guidelines for the treatment of malaria. 3rd ed. Geneva: WHO; 2015. ISBN 978-92-4-1549127.Google Scholar
  5. Saunders DL, Vanachayangkul P, Lon C. Dihydroartemisinin–piperaquine failure in Cambodia. N Engl J Med. 2014;371:484–5.View ArticlePubMedGoogle Scholar
  6. Taylor SM, Parobek CM, DeConti DK, Kayentao K, Coulibaly SO, Greenwood BM, et al. Absence of putative artemisinin resistance mutations among Plasmodium falciparum in Sub-Saharan Africa: a molecular epidemiologic study. J Infect Dis. 2015;211:680–8.View ArticlePubMedGoogle Scholar
  7. Menegon M, Pearce RJ, Inojosa WO, Pisani V, Abel PM, Matondo A, et al. Monitoring for multidrug-resistant Plasmodium falciparum isolates and analysis of pyrimethamine resistance evolution in Uige province, Angola. Trop Med Int Health. 2009;14:1251–7.View ArticlePubMedGoogle Scholar
  8. Duraisingh MT, Jones P, Sambou I, von Seidlein L, Pinder M, Warhurst DC. The tyrosine-86 allele of the pfmdr1 gene of Plasmodium falciparum is associated with increased sensitivity to the anti-malarials mefloquine and artemisinin. Mol Biochem Parasitol. 2000;108:13–23.View ArticlePubMedGoogle Scholar
  9. Palmieri F, Petrosillo N, Paglia MG, Conte A, Goletti D, Pucillo LP, et al. Genetic confirmation of quinine-resistant Plasmodium falciparum malaria followed by postmalaria neurological syndrome in a traveler from Mozambique. J Clin Microbiol. 2004;42:5424–6.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Korsinczky M, Chen N, Kotecka B, Saul A, Rieckmann K, Cheng Q. Mutations in Plasmodium falciparum cytochrome b that are associated with atovaquone resistance are located at a putative drug-binding site. Antimicrob Agents Chemother. 2000;44:2100–8.View ArticlePubMedPubMed CentralGoogle Scholar
  11. Miotto O, Almagro-Garcia J, Manske M, Macinnis B, Campino S, Rockett KA, et al. Multiple populations of artemisinin-resistant Plasmodium falciparum in Cambodia. Nat Genet. 2013;45:648–55.View ArticlePubMedGoogle Scholar
  12. Ariey F, Witkowski B, Amaratunga C, Beghain J, Langlois AC, Khim N, et al. A molecular marker of artemisinin-resistant Plasmodium falciparum malaria. Nature. 2014;505:50–5.View ArticlePubMedGoogle Scholar
  13. Tan K, Magill A, Parise M, Arguin P. Doxycycline for malaria chemoprophylaxis and treatment: report from the CDC expert meeting on malaria chemoprophylaxis. Am J Trop Med Hyg. 2011;84:517–31.View ArticlePubMedPubMed CentralGoogle Scholar
  14. Gomes M, Vieira J, Couto Á, Couto V, Vieira M, Pereira F, Machado R. Recurrence of Plasmodium falciparum after treatment with quinine and doxycycline in the Amazon basin. Trop Med Int Health. 2016;22:133–8.View ArticlePubMedGoogle Scholar
  15. Haghdoost AA, Alexander N. Systematic review and meta-analysis of the interaction between Plasmodium falciparum and Plasmodium vivax in humans. J Vector Borne Dis. 2007;44:33–43.PubMedGoogle Scholar
  16. WHO. World Malaria Report 2015. Geneva: WHO; 2015. ISBN 978-92-4-156515-8.Google Scholar
  17. Saunders DL, Chaorattanakawee S, Gosi P, Lanteri C, Somethy S, Kuntawunginn W, et al. Atovaquone–proguanil remains a potential stopgap therapy for multidrug-resistant Plasmodium falciparum in areas along the Thai-Cambodian border. Antimicrob Agents Chemother. 2016;60:1896–8.View ArticlePubMed CentralGoogle Scholar


© The Author(s) 2017


By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
