Skip to main content
Download PDF

Measuring entomological parameters before implementing a study on asymptomatic carriers of Plasmodium falciparum in the Zè District in southern Benin

Malaria Journal volume 22, Article number: 24 (2023) Cite this article

Abstract

Background

The objective of this study was to estimate malaria transmission and insecticide resistance status in malaria vectors in Adjrako village from Zè District in Southern Benin. The present study was carried out prior to investigations on infectivity of blood from asymptomatic carriers of Plasmodium falciparum to malaria vector mosquitoes.

Methods

Human landing collections (HLCs) were performed in Adjrako village during the rainy season (September—November 2021). In this village, host-seeking mosquitoes were collected during three nights per survey from 22:00 to 06:00 in six randomly selected houses. Malaria vectors were dissected in orders to determinate their parity. Plasmodium falciparum infection in malaria vectors was determined by qPCR and the entomological inoculation rate (EIR) was calculated. The World Health Organization (WHO) insecticide susceptibility test-kits were used to evaluate the susceptibility of Anopheles gambiae sensu lato (s.l.) to deltamethrin at 0.05% and bendiocarb at 0.1%.

Results

A total of 3260 females of mosquitoes belonging to 4 genera (Anopheles, Culex, Aedes and Mansonia) were collected. Most of the mosquitoes collected were An. gambiae sensu lato (s.l.). The entomological inoculation rate (EIR) for the three collection months was 8.7 infective bites per person and the parity rate was 84%. Mortality rates of An. gambiae s.l. exposed to 0.05% deltamethrin and 0.1% bendiocarb were 18% and 96%, respectively, indicating that this vector population was resistant to deltamethrin and possibly resistant to bendiocarb in the study area.

Conclusion

This study showed that malaria transmission is effective in the study area and that An. gambiae s.l. is the main malaria vector. The entomological parameters indicate this study area is potentially favourable for investigations on P. falciparum asymptomatic carriers.

Background

Despite intensified interventions and recent control efforts, malaria remains a public health problem. In the WHO African Region, malaria cases and deaths increased in 2021 from 213 to 228 million, and from 534,000 to 602,000, respectively [1]. In Benin, malaria is the first cause of hospitalization and healthcare use and represents 46.8% of the reasons for consultation in the population [2]. The incidence and mortality of malaria in the Beninese population are 14.6% and 0.9‰, respectively [3].

Malaria is caused by Plasmodium falciparum transmitted by female Anopheles. Out of the 476 Anopheles species, approximately 70 are competent of transmitting malaria [4]. In tropical Africa, the main vectors are Anopheles gambiae, Anopheles arabiensis, Anopheles funestus, Anopheles nili, Anopheles moucheti, Anopheles melas and Anopheles merus [5]. These malaria vectors belong to species complexes or groups of species [6] and exploit a wide variety of water collections as breeding sites, including residual pools of sunny stagnant surfaces, vegetated pools and brackish waters [7]. In Benin, the dominant vectors of P. falciparum are An. gambiae sensu lato (s.l.), An. funestus [8] and An. nili [9].

Malaria transmission is most active during the rainy season, which is the most favourable period for vector proliferation. In Africa, transmission is generally high and the entomological inoculation rates (EIR) are frequently greater than 100 infective bites/person/year and can reach 1000 infective bites/person/year. Transmission is heterogeneous and varies according to the areas [10, 11]. In Benin, malaria transmission varies considerably from one region to another and is higher in rural than in urban areas. From south to north, transmission is high in a Guinean climate (June–August); low in a sub-equatorial climate (March–August; October–November); continuous moderate in a Sudano-Sahelian climate and perennial in a Sudanese climate. The entomological inoculation rate varies between 0 and 8 bites per person per night [12,13,14]. Insecticide resistance in malaria vectors represents a concern for the success of malaria control programmes [1]. These vectors are becoming more and more resistant to pyrethroids and other classes of insecticides [15,16,17]. Previous studies in several regions have reported the emergence and expansion of insecticide resistance in malaria vectors, particularly to bendiocarb and deltamethrin [18,19,20,21].

Several strategies to control malaria have been developed, including vector control, which is the main means of preventing malaria transmission. According to World Health Organization (WHO) recommendations, this control is based mainly on the use of insecticide-treated nets (ITNs) and indoor residual spraying (IRS) [1]. ITNs and IRS have been shown to be effective in reducing malaria-related morbidity and mortality [22, 23]. Over the past decades, worldwide and regional efforts have led to a sharp decline in malaria-related morbidity and mortality. Indeed, between 2001 and 2013, the dramatic scale-up of malaria control interventions contributed to a 47% reduction in malaria mortality rates in the world, averting an estimated 4.3 million deaths [24].

In order to continue to successfully control malaria, new strategies must be developed to interrupt transmission in parasite-carrying subjects. For example, reducing transmission from humans to mosquitoes could greatly improve the efforts of control programmes. Thus, before implementing a study on the infectivity of P. falciparum asymptomatic carriers for malaria vectors, it is important to conduct an entomological study to determine the composition of mosquito populations, to assess the resistance status of An. gambiae to insecticides, and to estimate malaria transmission in the selected area.

Methods

Collections of larvae and adult mosquitoes were carried out in this study.

Study area

The study was carried out in Adjrako, a village in the arrondissement of Yokpo in the Zê District. Adjrako village was selected based on accessibility during the rainy season and the proximity with the laboratory research. The estimated population of this village is 800 inhabitants. The Zê District is located in the North-East of the Atlantic department (between 6°32ʹ and 6°87ʹ North latitude and between 2°13ʹ and 2°36ʹ East longitude) (Fig. 1). The average annual rainfall is 1257.95 mm and the average temperature is 27.4 °C. The climate of the Zè District is characterized by the 4 seasons: 2 rainy seasons from April to July and from September to November and 2 dry seasons from December to March and in August. The hydrographic network of the district of Zè is not very dense. The presence of shallows and water courses in this district provides facilities for the cultivation of corn, cassava, pineapple and peanuts. Long-lasting insecticidal nets (LLINs) represent the main malaria vector control intervention in Adjrako; LLINs are freely distributed by the government every 3 years [25].

Fig. 1
figure 1

Map of study area

Full size image

Adult mosquito collection

Three entomological surveys were conducted in the study area. Surveys were carried out from September to November 2021 corresponding to the short rainy season. At each survey, we performed human landing collections (HLCs) in the Adjrako village according to the method used by Coffinet et al. [26]. Host-seeking mosquitoes were collected during 3 consecutive nights per survey from 22:00 to 06:00 inside and outside in six randomly selected houses. Mosquito collection houses were not varied throughout the study. Mosquitoes were collected by 12 collectors (composed exclusively of males and at least 18 years of age) at each survey. Each selected house had one mosquito collector indoors and one collector outdoors. Each night of collection, one technician from the Centre for Research in Entomology of Cotonou (CREC) assisted by one local supervisor supervised the mosquito collections in this village, to ensure that they were performed properly. Mosquitoes collected were stored individually in tubes and closed with cotton wool and then kept in small bags by time slot and collection point. All mosquitoes collected were returned to the laboratory, examined under a binocular loupe, and identified using identification keys [27]. It is an illustrated key presenting, in the form of drawings, the characters corresponding to each species of mosquito.

Anopheles vector processing

After morphological identification, only An. gambiae s.l. and An. funestus mosquitoes were kept and were dissected in order to determinate their parity according to the appearance of the ovarian tracheoles. Dissection of mosquito ovaries was performed in distilled water with appropriate forceps. After dissection, the status of the tracheoles on the ovaries was examined under a microscope. In nulliparous females, the tracheoles were found to be rolled up and unrolled in parous females [28]. The head-thorax complex of each mosquito was cut and stored individually in 1.5 ml eppendorf tubes for detection for infection (vectors carrying P. falciparum sporozoites) by the quantitative PCR (qPCR). The mosquito carcasses (wings, legs and abdomen) were conserved in silica gel and stored at − 20 °C.

Detection of Plasmodium in malaria vectors

The head-thorax portion of each Anopheles was ground in a blocking buffer [29]. Genomic DNA was extracted from the head-thorax grindings of each mosquito using the DNeasyH Blood & Tissue kit (Qiagen) as recommended by the manufacturer. This procedure has been validated for the detection of Plasmodium in mosquitoes [30]. A SYBR Green real-time PCR restriction fragment length polymorphism assay (cytb-qPCR) targeting the cytochrome b gene of the human Plasmodium species was used [31]. To distinguish between P. falciparum and non-P. falciparum species, P. falciparum specific primer was used. For the cytochrome b gene (cytb) qPCR assay, the primers used were:

Pf_cytb_ TTGGTGCTAGAGATTATTCTGTTCCT) and Pf_cytb_ GGAGCTGTAATCATAATGTGTTCGTC) [32].

The PCR reaction was carried out in a final volume of 20 μl, containing 5 μl of extracted DNA, 0.25 μM of each primer. A fluorescence reading for each sample was taken. Tested DNA samples were scored P. falciparum positive when pf_cytb qPCR gave a Ct (cycle threshold) ≤ 22.35 with a melt curve and temperature similar to corresponding positive controls. All amplification and melt curves were individually inspected by eye.

Characteristics of breeding sites

In addition to collecting adult mosquitoes, we collected larvae and characterized their breeding sites as follows. All breeding sites visited and explored during this survey were geo-referenced using Geographical Positioning System (GPS) device integrated in smartphone. The mapping of these sites was carried out using ArcGIS version 10.3 software. All breeding sites with at least one Anopheles gambiae s.l. larva were considered positive and the others negative. For each larval site, the type of breeding site (puddle, floor tanks, plastic containers, village pump) was noted and its area classified as: (i) small area (< 1 m2); (ii) medium area (1–5 m2) or (iii) large area (> 5 m2). The nature of sites in which larvae were collected was noted as: polluted, unpolluted, permanent, semi-permanent, temporary, sunny, not sunny or partially sunny.

Larvae and pupae collection and density determination

Larval surveys were carried out in the village and its surroundings. Collections of water likely to harbor pre-imaginal stages of mosquitoes were prospected according to the method used by Coffinet et al. [26]. Larvae and pupae were collected once during the study period from several breeding sites in the village using the dipping method [33]. Before sampling, a waiting period of few minutes was observed to allow mosquito larvae, if there were any, to rise to the surface of the water. The mosquito larvae were morphologically identified to the genus level using reference keys [34]. Larvae and pupae collected were kept in plastic containers with a little water. The average larval and pupal densities (for 3 dips) obtained in each site were registered. The larvae and pupae were reared in the insectarium of Center for Research in Entomology of Cotonou (CREC) in a room with a relative humidity between 70 and 80% and a temperature between 25 and 30 °C. Photoperiod was of 12 h of light and 12 h of darkness.

Bioassays

Female mosquitoes aged 2–5 days obtained from larvae and pupae and morphologically identified as An. gambiae s.l. were exposed to doses of deltamethrin (0.05%) and bendiocarb (0.1%) as described in the standard WHO testing protocol [35]. For each insecticide, 4 replicates of 25 mosquitoes were exposed for 1 h to the treated papers. As a control, 4 others batches of 25 mosquitoes were exposed to untreated papers. The number of mosquitoes knocked down by the insecticide after 60 min of exposure was registered. After 60 min of exposure, the mosquitoes were fed with a 10% glucose solution and observed for 24 h. After 24 h of observation, mortality rates were determined. The resistance status of mosquitoes in the study area was determined according to WHO criteria [35].

Data analysis

Human biting rate (HBR) was expressed as the number of bites/person per time unit. The sporozoite rate (SR) was calculated as the proportion of mosquitoes found positive by qPCR out of the total tested. The Entomological Inoculation Rate (EIR) was calculated according to the formula: EIR = HBR x SR. The parity rate was expressed as the percentage of parous mosquitoes out of the total dissected. The Pearson correlation coefficient test was used to determine the linear correlation between longevity and malaria vector transmission using Statistica version 7.0.61.0 EN. Mosquito susceptibility and resistance to insecticides was defined according to WHO criteria [35]: mortality > 98% indicates a susceptible population; mortality between 90 and 98% suspected resistance and mortality < 90% indicates a resistant population.

Results

Culicidae fauna

During this study, 3260 adult mosquitoes were captured inside and outside of houses. Four genera (Anopheles, Culex, Aedes and Mansonia) with seven species of mosquitoes (An. gambiae s.l, An. funestus, Anopheles ziemanni, Culex gr decens, Culex quinquefasciatus, Culex annulioris, Aedes aegypti and Mansonia africana) were identified in the area (Table 1). Anopheles gambiae s.l. and An. funestus are species complexes that are each comprised of several different species that are morphologically indistinguishable. The genera Culex, Aedes and Mansonia constituted 92.85% (3027/3260), 0.61% (20/3260) and 3.59% (117/3260) of mosquitoes captured respectively. Anopheles species were weakly represented with 2.85% (93/3260) for An. gambiae s.l., 0.06% (2/3260) for An. funestus and 0.03% (1/3260) for An. ziemanni. Anopheles gambiae was the most abundant Anopheles species and constituted 97% (93/96) of the Anopheles population captured.

Table 1 Diversity of mosquito species in Adjrako during the three surveys
Full size table

Human biting rate, longevity, entomological inoculation rate and Plasmodium falciparum infection

In this study, the majority of Anopheles mosquitoes were collected inside houses (Table 2). Malaria vectors bites occurred principally from 23:00 to 06:00 both indoor and outdoor (Fig. 2). The peak of human biting rate was between 03:00 and 04:00 and was observed inside the houses. Human biting rate was 96.7 bites per person were recorded inside houses and 61.7 outside for three months of collection. The data concerning the number of mosquitoes captured per time slot, the human biting rate, the number tested and positive for qPCR, the entomological inoculation rate were showed in the Additional file 1.

Table 2 Longevity and Plasmodium falciparum infection in malaria vectors in Zè District during the study
Full size table
Fig. 2
figure 2

Malaria vectors biting rhythm indoor and outdoor

Full size image

The overall parity rate of the collected malaria vectors was 84% (Table 2). All malaria vectors captured were tested for infective P. falciparum sporozoites by qPCR. For An. gambiae s.l. the SR was 10.75% (10 positive head-thoraces out of 93 tested) whereas neither of the two An. funestus was positive (SR = 0%). The overall entomological inoculation rate (EIR) for the three collection months (period from September to November corresponding to the short rainy season) was 8.7 infective bites per person. Statistical analysis showed that there was a significantly positive correlation between vector longevity and transmission in the study area (r = 0.07 and p < 0.05).

Characteristics of breeding sites

The results on the characteristics of the breeding sites are presented in Table 3. A total of 12 breeding larval sites were geo-referenced. Among these sites, 5 contained at least one Anopheles larva. The other sites without Anopheles were considered as negative sites. Most of the larval breeding habitat (91.66% n = 11/12) were temporary sites composed mainly of puddles (75% n = 9/12) that were formed after the rains. Concerning the level of pollution, 9 of the sites (75% n = 9/12) were polluted and the majority of the geo-referenced sites (83.33% n = 10/12) had an average surface area. The mosquito larvae observed in the sites were Culex larvae, Anopheles larvae and a mixture of the two genera. The average larval and pupal densities calculated after 3 dips in each of the Anopheles positive sites were highly variable (Table 3). The minimum larval density was 1 larva per dip and the maximum was 23 larvae per dip. As for the pupal density, it was a minimum of 1 pupa per dip and a maximum of 13 per dip.

Table 3 Characteristics of larval breeding sites
Full size table

Vector resistance status

The results of the susceptibility tests showed the knock down (KD) rate of Anopheles collected in the study village after 60 min exposure to 0.05% deltamethrin was 35%, and the mortality rate 24 h after exposure was 18%. These susceptibility tests showed that malaria vector population was resistant to deltamethrin. In contrast, after exposure to 0.1% bendiocarb, the KD and mortality rates were 95% and 96%, respectively (Fig. 3). These results show a possible resistance to bendiocarb in the study area.

Fig. 3
figure 3

Knock-down and mortality rate of female Anopheles gambiae s.l. exposed to insecticide

Full size image

Discussion and conclusion

Four mosquito genera and seven species were collected during entomological surveys carried out in the Adjrako village. The An. gambiae complex was the main malaria vector with 8.7 infected bites per person for the period from September to November. This malaria vector was resistant to deltamethrin.

Seven species collected during the present study are lower than that recorded by Djènontin et al. [8] in Ouidah-Kpomasse-Tori health zone in southern Benin and Yadouléton et al. [36] in the District of Corpargo in the North-East of Benin, but is consistent to those recorded by Djègbè et al. [37] in Lélé, in southern Benin. Although Ouidah-Kpomasse-Tori health zone and the district of Zè are located on the same plateau of Allada, lower species numbers were recorded in the present study. These results could be explained by large surface area of the study conducted by Djènontin et al. [8]. Indeed, these authors have carried entomological surveys in 28 villages in 3 districts, in contrast with the present study carried out in 1 district. This suggested a probable heterogeneity in mosquitoes distribution on the plateau of Allada. Similarly, this difference observed at the species level with these authors could be related to the identification method used. Only morphological identification with a taxonomic key was used in this study, while other authors had also used molecular method; a more advanced method in the determination of species. In the same, the lower species number could be explained by the relatively short mosquitoes collection period.

Regarding the species richness of the different malaria vectors collected in this study, two potential vectors An. gambiae s.l. and An. funestus were collected. Anopheles gambiae s.l. was the most abundant species of the anopheline fauna and the majority was captured inside the houses, confirming the endophagous nature of this species. The density of An. gambiae s.l. obtained in this study was very low compared to that obtained by Djègbè et al. [37]; this low density could be related to the hydro-geographical factors of the study area. The study by Djègbè et al. [37] was conducted in a rice-growing area. As reported in several studies, rice fields are a favourable environment for the larval development of this species [38, 39]. The number of An. funestus vectors caught in this study was very low. This result suggests that breeding sites for this species are rare or scarce in the study area as An. funestus species prefer shaded sites with vegetative broods [34]. Although this species has a nocturnal biting behaviour especially in the second part of the night [40, 41], it could shift its biting time, as was reported by others [42, 43] who had observed females of this species biting at the beginning of the day. The continuation of the collection of mosquitoes until 09.00 in the morning could give more information on the density of this species.

The high rate of Culex genus observed in this study could be explained by the abundance of polluted breeding sites that were favourable for the proliferation of Culex larvae [44]. These observations corroborate those made by the studies that have shown that mosquito species belonging to the Culicinae have strong adaptive capacities allowing them to develop in polluted environments [45, 46]. Similar observations have been made by Koumba et al. [47], who showed that immature stages of the genus Culex are found in the larval sites rich in organic matter.

The larval surveys carried out in the context of this study showed that the study area has a diversity of larval sites. The majority of Anopheles larval sites identified in this study were temporary, unpolluted and sunny puddles sites. This result corroborates those of some authors who have shown that An. gambiae s.l. females prefer to lay their eggs in sunny water collections devoid of vegetation [39, 48]. However, the very low number of positive Anopheles breeding sites identified is probably associated to the heavy rains observed in the study area a few days before the larval surveys. These rains would have washed away several breeding grounds which would be favourable to the development of Anopheles larvae. The cohabitation of Anopheles and Culex larvae in the same breeding site suggests that Culex is able to survive in both clean and polluted habitats.

Populations of An. gambiae, the main malaria vector collected in this village, have developed resistance to deltamethrin and possibly resistance to bendiocarb. The results obtained in this study corroborate those of Djègbè et al. [21], who observed deltamethrin resistance in the same district, but with a mortality rate of 86%. The massive and sometimes abusive use over the years of household insecticides, such as aerosol cans, coils and especially the emergence of other insecticidal chemicals used against mosquito bites could certainly have contributed in one way or another to the selection of this resistance. Resistance of An. gambiae s.l. to deltamethrin had been previously reported in Benin [19, 20, 37].

The possibly resistance of mosquitoes to bendiocarb observed in our study is believed to be due to the massive use of pesticides in the agricultural environment in the Zè district. Indeed, pineapple cultivation is the most recurrent product in agricultural production in Zè district and farmers often resort to the use of chemicals, such as insecticides, herbicides or fungicides for various reasons [49,50,51].

Malaria transmission in the study area seems to be carried out mainly by Anopheles gambiae s.l., the major vector of malaria in Benin [8, 50, 52, 53]. The qPCR results confirmed that no infected An. funestus was found, but in view of the low number of An. funestus collected this may not be conclusive. The infectivity of this vector has been observed in southern Benin by several studies [8, 54, 55].

Determination of plasmodial infection by qPCR in mosquito heads and thorax showed that 11% of mosquitoes were infected. Seen that PCR-based methods detect Plasmodium in stages other than sporozoites, sporozoite index observed in the present study could be an overestimate [56].

The overall EIR for this study was 8.7 infecting bites per person for the period from September to November (corresponding to the short rainy season). The transmission was highest in September which corresponds to the beginning of the short rainy season with EIR 6.1 infecting bites per person and zero in November which marks the end of this season. This suggests that, the population of Zè is much more exposed to P. falciparum transmission during rainy seasons when mosquitoes are abundant. These results corroborate those obtained in a northern region which showed that transmission is very high in the rainy season than in the dry season [36]. This information is likely to favour the carriage of Plasmodium in the Adjrako population especially in the rainy season. Asymptomatic carriage of malaria parasites being common in all malaria-endemic areas [57], so the village of Adjrako is a very favourable location for the implementation of the study on the infectivity of asymptomatic carriers of P. falciparum.

This transversal study on entomological parameters provides a data set on malaria transmission in the village of Adjrako in the district of Zè. However, the three months data collection periods corresponding to the short rainy season are insufficient to assess culicidian diversity and malaria transmission in this district. A longitudinal study would be necessary to measure the variability of malaria vectors and the physico-chemical and biological parameters of the larval sites over all seasons of the year. Despite its limits, the data from this study are importance for the study for which it was collected. Indeed, the main vector of malaria in the study area is known and this can orientate the tests to be carried out within the framework of the study on asymptomatic carriers which will be set up.

Availability of data and materials

The raw data used in this study are available from the corresponding author upon reasonable request.

Abbreviations

CREC:

Centre de recherche entomologique de cotonou

HLCs:

Human landing collections

Cytb:

Cytochrome b

DNA:

Deoxyribonucleic acid

EIR:

Entomological inoculation rate

GPS:

Geographical positioning system

IRS:

Indoor residual spraying

ITNs:

Insecticide-treated nets

KD:

Knock down

PCR:

Polymerase chain reaction

Pf_cytb:

Plasmodium falciparum cytochrome b

qPCR:

Quantitative polymerase chain reaction

Ct:

Cycle threshold

SYBR:

Synergy brands

WHO:

World Health Organization

References

  1. WHO. World malaria report. Geneva: World Health Organization; 2021.

    Google Scholar 

  2. Ministère de la Santé du Bénin. Annuaire des Statistiques Sanitaires Année 2019. Cotonou, Bénin, 2019; 244p.

  3. Ministère de la santé du Bénin. Plan national de développement sanitaire 2018–2022. 2018; 82p.

  4. Service MW. Medical entomology for students. 5th ed. Cambridge: Cambridge University Press; 2012.

    Book  Google Scholar 

  5. Carnevale P, Robert V, Manguin S, Corbel V, Fontenille D, Garros C, et al., editors. Les Anophèles: Biologie, transmission du Plasmodium et lutte antivectorielle. Anophèles Biol Transm Plasmodium Lutte Antivectorielle. Marseille: IRD Éditions; 2009; 402p.

  6. Fontenille D, Cohuet A, Awono-Ambene P, Kengne P, Antonio-Nkondjio C, Wondji C, et al. Vecteurs de paludisme: du terrain à la génétique moléculaire Recherches en Afrique. Rev Epidemiol Sante Publique. 2005;53:283–90.

    Article  CAS  Google Scholar 

  7. Mouchet J, Carnevale P, Coosemans M, Julvez J, Richard Lenoble D, Sircoulon J. Biodiversité du paludisme dans le monde. Montrouge: John Libbey Publ; 2004.

    Google Scholar 

  8. Djènontin A, Bio-Bangana S, Moiroux N, Henry M-C, Boussari O, Chabi J, et al. Culicidae diversity, malaria transmission and insecticide resistance alleles in malaria vectors in Ouidah-Kpomasse-Tori district from Benin (West Africa): a pre-intervention study. Parasit Vectors. 2010;3:83.

    Article  Google Scholar 

  9. Ossè RA, Tokponnon F, Padonou GG, Sidick A, Aïkpon R, Fassinou A, et al. Involvement of Anopheles nili in Plasmodium falciparum transmission in North Benin. Malar J. 2019;18:152.

    Article  Google Scholar 

  10. Tchuinkam T, Simard F, Lélé-Defo E, Téné-Fossog B, Tateng-Ngouateu A, Antonio-Nkondjio C, et al. Bionomics of Anopheline species and malaria transmission dynamics along an altitudinal transect in Western Cameroon. BMC Infect Dis. 2010;10:119.

    Article  Google Scholar 

  11. Smith T, Maire N, Dietz K, Killeen GF, Vounatsou P, Molineaux L, et al. Relationship between the entomologic inoculation rate and the force of infection for Plasmodium falciparum malaria. Am J Trop Med Hyg. 2006;75:11–8.

    Article  Google Scholar 

  12. Gnanguenon V, Govoetchan R, Agossa FR, Ossè R, Oke-Agbo F, Azondekon R, et al. Transmission patterns of Plasmodium falciparum by Anopheles gambiae in Benin. Malar J. 2014;13:444.

    Article  Google Scholar 

  13. Govoetchan R, Gnanguenon V, Azondékon R, Agossa RF, Sovi A, Oké-Agbo F, et al. Evidence for perennial malaria in rural and urban areas under the Sudanian climate of Kandi Northeastern Benin. Parasit Vectors. 2014;7:79.

    Article  Google Scholar 

  14. Salako AS, Ahogni I, Kpanou C, Sovi A, Azondekon R, Sominahouin AA, et al. Baseline entomologic data on malaria transmission in prelude to an indoor residual spraying intervention in the regions of Alibori and Donga, Northern Benin. West Africa Malar J. 2018;17:392.

    Google Scholar 

  15. Mzilahowa T, Chiumia M, Mbewe RB, Uzalili VT, Luka-Banda M, Kutengule A, et al. Increasing insecticide resistance in Anopheles funestus and Anopheles arabiensis in Malawi, 2011–2015. Malar J. 2016;15:563.

    Article  Google Scholar 

  16. Matowo NS, Munhenga G, Tanner M, Coetzee M, Feringa WF, Ngowo HS, et al. Fine-scale spatial and temporal heterogeneities in insecticide resistance profiles of the malaria vector, Anopheles arabiensis in rural south-eastern Tanzania. Wellcome Open Res. 2017;2:96.

    Article  Google Scholar 

  17. Hancock PA, Hendriks CJM, Tangena J-A, Gibson H, Hemingway J, Coleman M, et al. Mapping trends in insecticide resistance phenotypes in African malaria vectors. PLoS Biol. 2020;18: e3000633.

    Article  CAS  Google Scholar 

  18. Aïkpon R, Agossa F, Ossè R, Oussou O, Aïzoun N, Oké-Agbo F, et al. Bendiocarb resistance in Anopheles gambiae s.l. populations from Atacora department in Benin, West Africa: a threat for malaria vector control. Parasit Vectors. 2013;6:192.

    Article  Google Scholar 

  19. Sovi A, Djègbè I, Soumanou L, Tokponnon F, Gnanguenon V, Azondékon R, et al. Microdistribution of the resistance of malaria vectors to deltamethrin in the region of Plateau (southeastern Benin) in preparation for an assessment of the impact of resistance on the effectiveness of Long Lasting Insecticidal Nets (LLINs). BMC Infect Dis. 2014;14:103.

    Article  Google Scholar 

  20. Yahouédo GA, Cornelie S, Djègbè I, Ahlonsou J, Aboubakar S, Soares C, et al. Dynamics of pyrethroid resistance in malaria vectors in southern Benin following a large scale implementation of vector control interventions. Parasit Vectors. 2016;9:385.

    Article  Google Scholar 

  21. Djègbè I, Toponon F, Gbankoto A, Tchigossou G, Djossou-Hessou D, Dossou C, et al. Typologie des gîtes larvaires et résistance des vecteurs du paludisme a la deltaméthrine dans les milieux urbain et rural du Département de l’Atlantique au sud du Bénin: données préliminaires. Eur Sci J. 2019;15:171.

    Google Scholar 

  22. Lengeler C. Insecticide-treated bed nets and curtains for preventing malaria. Cochrane Database Syst Rev. 2004;2:CD000363.

    Google Scholar 

  23. Pluess B, Tanser F, Lengeler C, Sharp B. Indoor residual spray for preventing malaria (Review). Cochrane Database Syst Rev. 2010. https://doi.org/10.1002/14651858.CD006657.pub2/abstract.

    Article  Google Scholar 

  24. WHO. World Malaria Report. Geneva: World Health Organization; 2014.

    Google Scholar 

  25. Fahala, A.A. monographie de la commune de Zè, Programme d’appui au démarrage des communes, Afrique Conseil. 2006; 27p.

  26. Coffinet T, Rogier C, Pages F. Evaluation de l’agressivité des anophèles et du risque de transmission du paludisme: méthodes utilisées dans les Armées françaises. Med Trop (Mars). 2009;69:109–22.

    CAS  Google Scholar 

  27. Gillies MT, De Meillon B. The Anophelinae of Africa south of the Sahara (Ethiopian zoogeographical region). Johannesburg: South African Institute for Medical Research; 1968; 54: 343p.

  28. Detinova TS, Gillies MT. Observations on the determination of the age composition and epidemiological importance of populations of Anopheles gambiae Giles and Anopheles funestus Giles in Tanganyika. Bull World Health Organ. 1964;30:23–8.

    CAS  Google Scholar 

  29. Burkot TR, Williams JL, Schneider I. Identification of Plasmodium falciparum-infected mosquitoes by a double antibody enzyme-linked immunosorbent assay. Am J Trop Med Hyg. 1984;33:783–8.

    Article  CAS  Google Scholar 

  30. Sandeu MM, Moussiliou A, Moiroux N, Padonou GG, Massougbodji A, Corbel V, et al. Optimized pan-species and speciation duplex real-time PCR assays for Plasmodium parasites detection in malaria vectors. PLoS ONE. 2012;7: e52719.

    Article  CAS  Google Scholar 

  31. Xu W, Morris U, Aydin-Schmidt B, Msellem MI, Shakely D, Petzold M, et al. SYBR green real-time PCR-RFLP assay targeting the Plasmodium cytochrome b gene—a highly sensitive molecular tool for malaria parasite detection and species determination. PLoS ONE. 2015;10: e0120210.

    Article  Google Scholar 

  32. Henry B, Volle G, Akpovi H, Gineau L, Roussel C, Ndour PA, et al. Splenic clearance of rigid erythrocytes as an inherited mechanism for splenomegaly and natural resistance to malaria. EBioMedicine. 2022;82: 104167.

    Article  CAS  Google Scholar 

  33. Papierok B, Croset H, Rioux R. Estimation de l’effectif des populations larvaires d’Aedes (O.) cataphylla Dyar, 1916 (Diptera, Culicidae) : 2. Méthode utilisant le “coup de louche” ou “dipping.” Cah ORSTOM Sér Entomol Médicale Parasitol. 1975; 1: 47–51.

  34. Gillies M, Coetzee M. A supplement to the Anophelinae of Africa south of the Sahara (Afrotropical Region). Johannesburg South Afr Inst for Med Res. 1987;55:1–143.

    Google Scholar 

  35. OMS 2017. Procédures pour tester la résistance aux insecticides chez les moustiques vecteurs du paludisme. Seconde édition. Genève: Organisation mondiale de la Santé. 2017; 55p.

  36. Yadouleton A, Aikpon R, Houndeton G, Aboubacar S, Ursins F, Tchibçozo C, et al. Données entomologiques préliminaires pour la mise en place d’une pulvérisation intra-domiciliaire à grande échelle dans la commune de Corpargo au Nord-Est du Bénin. Int J Biol Chem Sci. 2018;12:1993–2003.

    Article  CAS  Google Scholar 

  37. Innocent D, Missihoun A, Djouaka R, Martin A. Surveillance entomologique: dynamique de la population et de la résistance aux insecticides chez Anopheles gambiae s.l. en milieu de riziculture irriguée au Sud Bénin. J Appl Biosci. 2017;111:10934–43.

    Google Scholar 

  38. Zahouli ZBJ, Tchicaya ES, Nsanzabana C, Donzé J, Utzinger J, N’Goran EK, et al. Caractéristiques bioécologiques d’Anopheles gambiae s.s. en zones de riziculture irriguée au centre de la Côte d’Ivoire. Med Trop (Mars). 2011;71:575–81.

    CAS  Google Scholar 

  39. Betsi AN, Tchicaya ES, Koudou BG. Forte prolifération de larves d’An. gambiae et An. funestus en milieux rizicoles irrigués et non irrigués dans la région forestière ouest de la Côte-d’Ivoire. Bull Soc Pathol Exot. 2012;3:220–9.

    Article  Google Scholar 

  40. Oyewole IO, Awolola TS. Impact of urbanisation on bionomics and distribution of malaria vectors in Lagos, southwestern Nigeria. J Vector Borne Dis. 2006;43:173–8.

    CAS  Google Scholar 

  41. Ayala D, Goff GL, Robert V, de Jong P, Takken W. Population structure of the malaria vector Anopheles funestus (Diptera: Culicidae) in Madagascar and Comoros. Acta Trop. 2006;97:292–300.

    Article  Google Scholar 

  42. Moiroux N, Gomez MB, Pennetier C, Elanga E, Djènontin A, Chandre F, et al. Changes in Anopheles funestus biting behavior following universal coverage of long-lasting insecticidal nets in Benin. J Infect Dis. 2012;206:1622–9.

    Article  CAS  Google Scholar 

  43. Sougoufara S, Diédhiou SM, Doucouré S, Diagne N, Sembène PM, Harry M, et al. Biting by Anopheles funestus in broad daylight after use of long-lasting insecticidal nets: a new challenge to malaria elimination. Malar J. 2014;13:125.

    Article  Google Scholar 

  44. Hadji M, Belghyti D, Elomari F, Assal ME, Marsini ME. Étude de la dynamique stationnelle des populations des culicidés dans la province de Sidi Slimane (Maroc). Afr Sci Rev Int Sci Technol. 2013;9:128–39.

    Google Scholar 

  45. Lalami AEO, Hilali OE, Benlamlih M, Merzouki M, Raiss N, Koraichi SI, et al. Etude entomologique, physicochimique et bactériologique des gîtes larvaires de localités à risque potentiel pour le paludisme dans la ville de Fès. Bull Inst Scient, Rabat. 2010;32:119–27.

    Google Scholar 

  46. Amara Korba R, Alayat MS, Bouiba L, Boudrissa A, Bouslama Z, Boukraa S, et al. Ecological differentiation of members of the Culex pipiens complex, potential vectors of West Nile virus and Rift Valley fever virus in Algeria. Parasit Vectors. 2016;9:455.

    Article  Google Scholar 

  47. Koumba AA, Koumba CRZ, Nguema RM, Djogbenou LS, Ondo PO, Ketoh GK, et al. Distribution spatiale et saisonnière des gîtes larvaires des moustiques dans les espaces agricoles de la zone de Mouila. Gabon Int J Biol Chem Sci. 2018;12:1754.

    Article  Google Scholar 

  48. Sy O, Konaté L, Ndiaye A, Dia I, Diallo A, Taïrou F, et al. Identification des gîtes larvaires d’anophèles dans les foyers résiduels de faible transmission du paludisme « hotspots » au centre-ouest du Sénégal. Bull Soc Pathol Exot. 2016;109:31–8.

    Article  CAS  Google Scholar 

  49. Houesssou AP, Aboubakar K, Houndji P, Vigninou T. Production agricole dans la commune de Zè: facteurs et contraintes. Int J Progress Sci Technol. 2020;23:152–62.

    Google Scholar 

  50. Yadouleton AWM, Asidi A, Djouaka RF, Braïma J, Agossou CD, Akogbeto MC. Development of vegetable farming: a cause of the emergence of insecticide resistance in populations of Anopheles gambiae in urban areas of Benin. Malar J. 2009;8:103.

    Article  Google Scholar 

  51. Aïzoun N, Aïkpon R, Gnanguenon V, Oussou O, Agossa F, Padonou GG, et al. Status of organophosphate and carbamate resistance in Anopheles gambiae sensu lato from the south and north Benin. West Africa Parasit Vectors. 2013;6:274.

    Article  Google Scholar 

  52. Akogbeto MC, Djouaka R, Noukpo H. Utilisation des insecticides agricoles au Bénin. Bull Soc Pathol Exot. 1990;2005(98):400–5.

    Google Scholar 

  53. Padonou GG, Gbedjissi G, Yadouleton A, Azondekon R, Razack O, Oussou O, et al. Decreased proportions of indoor feeding and endophily in Anopheles gambiae s.l. populations following the indoor residual spraying and insecticide-treated net interventions in Benin (West Africa). Parasit Vectors. 2012. https://doi.org/10.1186/1756-3305-5-262.

    Article  Google Scholar 

  54. Djouaka R, Riveron JM, Yessoufou A, Tchigossou G, Akoton R, Irving H, et al. Multiple insecticide resistance in an infected population of the malaria vector Anopheles funestus in Benin. Parasit Vectors. 2016;9:453.

    Article  Google Scholar 

  55. Ossè RA, Aïkpon R, Gbédjissi GL, Gnanguenon V, Sèzonlin M, Govoétchan R, et al. A shift from Indoor Residual Spraying (IRS) with bendiocarb to Long-Lasting Insecticidal (mosquito) Nets (LLINs) associated with changes in malaria transmission indicators in pyrethroid resistance areas in Benin. Parasit Vectors. 2013;6:73.

    Article  Google Scholar 

  56. Hendershot AL, Esayas E, Sutcliffe AC, Irish SR, Gadisa E, Tadesse FG, et al. A comparison of PCR and ELISA methods to detect different stages of Plasmodium vivax in Anopheles arabiensis. Parasit Vectors. 2021;14:473.

    Article  CAS  Google Scholar 

  57. Slater HC, Ross A, Felger I, Hofmann NE, Robinson L, Cook J, et al. The temporal dynamics and infectiousness of subpatent Plasmodium falciparum infections in relation to parasite density. Nat Commun. 2019;10:2644.

    Article  Google Scholar 

Download references

Acknowledgements

We thank the team and all the study participants for their willing‑ness to participant in the survey. We also thank the people of Adjrako village for their collaboration.

Funding

Not applicable.

Author information

Authors and Affiliations

  1. Centre de Recherche Pour La Lutte Contre Les Maladies Infectieuses Tropicales (CReMIT), Université d’Abomey-Calavi (UAC), BP 526, Cotonou, Bénin

    Aziz Bouraima, Armel Djènontin, Lenucthadius Houessou, Christophe Soares & Montchédé Anato

  2. Centre de Recherche Entomologique de Cotonou (CREC), 06 BP 2604, Cotonou, Bénin

    Aziz Bouraima, Armel Djènontin, Lenucthadius Houessou, Christophe Soares & Montchédé Anato

  3. Institut de Recherche Clinique du Bénin (IRCB), 04 BP 1114, Cotonou, Bénin

    Yannelle Dossou, Boris-Enock Zinsou & Achille Massougbodji

  4. Université Paris Cité, IRD, MERIT, 75006, Paris, France

    Célia Dechavanne, Jerome Clain & Gilles Cottrell

  5. Centre d’Etude Et de Recherche Sur Les Pathologies Associées À La Grossesse Et À L’Enfance (CERPAGE), Cotonou, Bénin

    Célia Dechavanne, Jerome Clain & Gilles Cottrell

Authors
  1. Aziz Bouraima
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Armel Djènontin
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Yannelle Dossou
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Lenucthadius Houessou
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Christophe Soares
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Montchédé Anato
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Boris-Enock Zinsou
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Célia Dechavanne
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Jerome Clain
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Achille Massougbodji
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Gilles Cottrell
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

AD and GC conceived the study. YD, CD and JC contributed for its implementation. AM oversaw the administration of the study. AB, CS, AM, LH and BEZ led the entomological field and laboratory activities. AB drafted the manuscript and analysed the data. AD provided critical comments on progressive drafts and all authors read and approved the final manuscript.

Corresponding author

Correspondence to Aziz Bouraima.

Ethics declarations

Ethics approval and consent to participate

The study was approved by the Institutional Ethic Committee of the Cotonou Entomological Research Centre (N° 026/CREC/CEI- CREC/SA). The study procedure, risks and benefits were explained to the mosquito collectors (volunteers) and their informed consent was obtained. All mosquito collectors and supervisors were vaccinated against yellow fever. Those diagnosed with malaria during the study period were treated free of charge according to national recommendations.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1

: Table S1. Hourly distribution of Human biting rate and Entomological Inoculation Rate.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Bouraima, A., Djènontin, A., Dossou, Y. et al. Measuring entomological parameters before implementing a study on asymptomatic carriers of Plasmodium falciparum in the Zè District in southern Benin. Malar J 22, 24 (2023). https://doi.org/10.1186/s12936-023-04450-4

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12936-023-04450-4

Keywords

Malaria Journal

ISSN: 1475-2875

Contact us