Skip to main content
Download PDF

Prevalence of G6PD deficiency and submicroscopic malaria parasites carriage in malaria hotspot area in Northwest, Tanzania

Malaria Journal volume 22, Article number: 372 (2023) Cite this article

Abstract

Background

The use of primaquine for mass drug administration (MDA) is being considered as a key strategy for malaria elimination. In addition to being the only drug active against the dormant and relapsing forms of Plasmodium vivax, primaquine is the sole potent drug against mature/infectious Plasmodium falciparum gametocytes. It may prevent onward transmission and help contain the spread of artemisinin resistance. However, higher dose of primaquine is associated with the risk of acute haemolytic anaemia in individuals with a deficiency in glucose-6-phosphate dehydrogenase. In many P. falciparum endemic areas there is paucity of information about the distribution of individuals at risk of primaquine-induced haemolysis at higher dose 45 mg of primaquine.

Methods

A retrospective cross-sectional study was carried out using archived samples to establish the prevalence of G6PD deficiency in a malaria hotspot area in Misungwi district, located in Mwanza region, Tanzania. Blood samples collected from individuals recruited between August and November 2010 were genotyped for G6PD deficiency and submicroscopic parasites carriage using polymerase chain reaction.

Results

A total of 263 individuals aged between 0 and 87 were recruited. The overall prevalence of the X-linked G6PD A− mutation was 83.7% (220/263) wild type, 8% (21/263) heterozygous and 8.4% (22/263) homozygous or hemizygous. Although, assessment of the enzymatic activity to assign the phenotypes according to severity and clinical manifestation as per WHO was not carried out, the overall genotype and allele frequency for the G6PD deficiency was 16.4% and 13. 2%, respectively. There was no statistically significant difference in among the different G6PD genotypes (p > 0.05). Out of 248 samples analysed for submicroscopic parasites carriage, 58.1% (144/248) were P. falciparum positive by PCR. G6PD heterozygous deficiency were associated with carriage of submicroscopic P. falciparum (p = 0.029).

Conclusions

This study showed that 16.4% of the population in this part of North-western Tanzania carry the G6PD A− mutation, within the range of 15–32% seen in other parts of Africa. G6PD gene mutation is widespread and heterogeneous across the study area where primaquine would be valuable for malaria control and elimination. The maps and population estimates presented here reflect potential risk of higher dose of primaquine being associated with the risk of acute haemolytic anaemia (AHA) in individuals with a deficiency in glucose-6-phosphate dehydrogenase and call further research on mapping of G6PD deficiency in Tanzania. Therefore, screening and education programmes for G6PD deficiency is warranted in a programme of malaria elimination using a higher primaquine dose.

Background

The current renewed effort for malaria elimination is aimed to spot hotspot areas to identify individuals having gametocytes for mass drug administration (MDA) [1,2,3]. Studies have indicated that sub-microscopic malaria carriage is common in the population [4,5,6]. Also, it is well documented that individuals carrying sub-microscopic parasites are the cause of seasonal malaria transmission [7]. The use of primaquine for mass drug administration is being considered as an option for parasite clearance to block transmission of Plasmodium falciparum in areas approaching malaria elimination [8, 9].

Universal efforts to attain malaria elimination have recently lead the World Health Organization (WHO) to recommend for a single dose of 0.25 mg/kg primaquine as a P. falciparum gametocytocide [10]. Furthermore, in areas of low malaria transmission, the WHO has recommended the inclusion of primaquine 0.75 mg base/kg (adult dose 45 mg) to artemisinin-based combination therapy (ACT) regimens for falciparum malaria [11]. However, there is a concern of using primaquine due to the haemolysis associated with the drug in Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency individuals [12]. Severity of haemolysis depends on the G6PD variant present, gender, ingestion of some foods (for example, fava beans) as well as dose and duration of primaquine exposure, causing haemolysis which sufficiently requires blood transfusion [13].

G6PD deficiency is an X-linked genetic disorder and about 400 million people worldwide have a deficiency of this enzyme [14]. G6PD is highly polymorphic, at least 186 mutations have been characterized in the G6PD gene [15], although not all are polymorphic and of clinical significance. The variants of G6PD include: the common G6PD B (wild type), G6PD A (non-deficient type) and G6PD A− (deficient type). Both G6PD A and G6PDA− differ from G6PD B by a variation at nucleotide 376 (A→G), and at the same time G6PD A− had an extra mutation at nucleotide 202 (G→A) [16, 17], the latter being predominant in sub-Saharan Africa. The wild-type B variant and A+ variant (which carries a single mutation at nucleotide 376), have normal or near-normal enzyme activities. With an additional mutation at nucleotide 202, the A− variant has approximately 12% of the wild type enzyme activity [18] and is normally associated with mild haemolysis. Other common G6PD deficiencies include: Mediterranean and Asia types, the differences related to the mutation’s position on chromosome and geographic locations [19, 20].

The enzyme G6PD protects against the oxidative stress of haemolytic anaemia induced by both infection and anti-malarials [21]. Despite the haemolytic stress associated with G6PD deficiency there are also reports of protection to malaria afforded by the enzyme deficiency [19, 22].

Studies have shown that asymptomatic P. falciparum infection is common in the population [4, 23, 24], and G6PD deficient individuals may be carrying malaria parasites without symptoms [25]. It is globally recognized that novel tools and strategies are required to eliminate foci of residual P. falciparum malaria transmission [26]. Primaquine is the only approved anti-malarial drugs used to eliminate hypnozoites of Plasmodium vivax and P. falciparum gametocytes [27,28,29]. Some studies on tolerance of primaquine undertaken in G6PD deficient individuals have suggested that, courses of lower dosage treatment as described by Hill [30,31,32] may be safe. However, safety concern remains related to the acute haemolytic anaemia associated with a higher primaquine doses which will be required to clear the radical P. vivax and Plasmodium ovale in G6PD deficient individuals [33, 34]. Therefore, given the wide genetic and phenotypic variability of G6PD, it is considered as priority to carry out phenotypic and genotypic analysis in different populations where primaquine MDA is being considered for elimination [35,36,37].

Misungwi district located in Mwanza region in Northwest Tanzania is an area with moderately malaria transmission; the overall prevalence of P. falciparum infection in the area is estimated to be 31.4% [38] and that the district is a malaria hotspot area [5, 23, 39]. A study carried out in the area, found that on average, 50% of household members are parasite carriers within hotspots [23]. Due to more frequent infections, these people have acquired higher levels of immunity to clinical malaria than those living outside the hotspots. As a consequence, they can remain asymptomatic for long periods of time, while acting as infectious reservoirs for onward transmission [4, 23]. It has been shown that submicroscopic carriage is common in different malaria transmission settings [4] and that submicroscopic P. falciparum gametocyte carriage is not uncommon in an area of low and seasonal malaria transmission and is a source of maintaining malaria transmission [40, 41], a campaign which requires primaquine dosing strategy to reduce haemolysis in individuals with G6PD deficiency. However, policy makers have been reluctant to implement this recommendation due to primaquine safety concerns and a lack of data on its efficacy [42].

While malaria transmission declines across to a great extent of its range and the likelihood of elimination is gradually more considered [43]; Misungwi district in Mwanza, North west Tanzania has been previously reported to be a malaria hotspot area and the results suggested that community-wide MDA, instead of screen and treat strategies, may be needed to successfully treat the asymptomatic, subpatent parasite reservoir and reduce transmission [23]. However, there is no studies which has been carried out assessing the frequency of G6PD deficiency. Therefore, there is a need to establish the distribution of G6PD deficiency in malaria hotspot area and identify individuals who may be carrying the malaria parasites (submicroscopic parasites) for mass drug administration for clearing of the parasites in individuals which may be a source of transmission. This study was carried out to map the distribution of G6PD deficiency in malaria hotspot area in Mwanza region located in North-western Tanzania which is important in resource poor-settings for future malaria elimination.

Methods

Study area

The study was conducted in Misungwi district (latitude 2.85000 S, longitude 33.08333 E) is located in Mwanza region, the northwest of Tanzania at an altitude of 1178 m above sea level, the district is situated 60 km from Mwanza town. The district has a moderate level of malaria transmission (meso-endemic). The district has two annual rainy seasons, the long rains between February and May and the short rains between November and December. The dry and relatively hot season is June to September. Transmission intensity has a seasonal cycle, with peaks in malaria incidence 1 to 2 months after the rains start. The prevalence of malaria infection in the region is estimated to be 31.4% by microscopy during a Demographic and Health Survey (DHS).

Study design

A retrospective cross-sectional study using archived samples for establishing the prevalence of G6PD deficiency in a malaria hotspot area was carried out in Misungwi district located in Mwanza region, Northwest of Tanzania.

Study population and sampling techniques

The study utilized blood samples collected from individuals living in four villages (Fig. 1) from August to November 2010 [23] who questionnaires were used to collect demographic and clinical information of the study participants. Any subject who reported a fever within the previous 24 h was tested for malaria using a histidine-rich protein 2 (HRP2) malaria rapid diagnostic test (RDT, Paracheck-Pf®, Orchid Biomedical Systems, Goa, India) and referred to a study clinician for management of their febrile illness as reported by Mosha et al. [23]. In this study, a purposive and random sampling was employed. Briefly, selection of archived filter paper blood samples from individuals in four villages in a single ward located in Northern part of Misungwi district was carried out and a random selection of samples from individuals in each village was used. However, individual presented with fever and RDT positive were excluded. Several studies have reported the prevalence of G6PD deficiency varies between 5 and 32.5% in malaria-endemic areas of Africa and Asia, and its geographical distribution overlaps with the distribution of malaria. The sample size calculation was based on G6PD deficiency prevalence of 11% in a lowland area carried out in Tanzania [44]. Hence, a minimum of 250 individuals was enough to be included in this study. For this study 263 study participants were recruited and provided blood specimen for G6PD deficiency assessment whereas a total of 248 samples from the same individuals were used for assessment of submicroscopic parasite carriage. Finger prick blood samples were collected on Standard 3MM Whatman filter paper, dried overnight at room temperature. The samples were individually sealed into plastic bags and stored with desiccant at − 20 °C.

Fig. 1
figure 1

(Adapted from Mosha et al. [23])

Location of the study site within Tanzania and distribution of households included in the study (red points) showing local topography and road network (grey lines)

Full size image

Sample processing and DNA extraction

Sample processing and the laboratory analyses were performed at the National Institute for Medical Research (NIMR), Mwanza Research Centre laboratory where DNA was extracted from filter papers using the QIAamp DNA Mini Kit (QIAGEN, UK), following manufacturer’s instructions.

G6PD deficiency genotyping (the G6PD A− allele (202G→A)

G6PD deficiency was genotyped by allele-specific PCR and followed by gel electrophoresis [27]. Briefly, G6PD deficiency variants (B, A and A−) was determined by a simple high-throughput method using PCR amplification with forward and reverse primers, 5′CTGGCCAAGAAGAAGATCTACC 3′ and 5′GAAAAACGCAGCAGAGCACAG 3′ respectively. DNA was amplified in a total reaction volume of 30 µl consisting of reaction buffer, 2 mM MgCl2, 0.1 µmol of each primer, 0.1 mM dNTPs each and 1 U of BioTaq DNA polymerase (Bioline). A touchdown programme was used to prevent non-specific amplification; an initial denaturation step at 95 °C for 5 min was followed by 14 cycles at 95 °C for 40 s, 68.5 °C for 40 s, and at 72 °C for 40 s, with annealing temperature decreasing 0.5 °C per cycle; the programme was completed by 23 additional cycles with annealing temperature 61 °C and a final extension step at 72 °C for 10 min. The amplified DNA fragments were digested by Restriction Fragment Length Polymorphism(RFLP) by the use of specific Restriction endonuclease “NalII” (NEBiolabs) at 37 °C for 4 h [27]. Agarose gel (Metaphor ™, Rockland, ME USA) of 3% was prepared for detection of G6PD variants, where 10 µl of DNA was loaded in the gel and allowed to run at 100 V for 1.30 h. Individuals were characterized as GG (normal), AG (heterozygous) and A−/AA (hemi/homozygous).

The genotype frequency and allele frequency in the population was calculated based on the following formula:

$${Genotype}\; {frequency}\;(\%) = {heterozygous}\; {individuals} + {homozygous}\; {individuals}/{total}\; {no.}\; {of}\; {individuals}\; {genotyped}.$$
$${Allele}\; {frequency}\; (\%) = (2{\text{X}}\; {\text{homozygous}}\; {\text{female}} + {\text{hemizygous}}\; {\text{male}} + {\text{heterozygous}}\; {\text{female}})/(2{\text{X}} \; {\text{female}}\; {\text{tested}} + {\text{male}}\; {\text{tested}}).$$

Assigning G6PD genotype to phenotype

The enzymatic activity to assign the phenotypes according to severity and clinical manifestation as per WHO recommendations [45] was not assessed. The phenotype in this study was deduced based on the genotype of a molecular detection of the G6PDA− G202A allele. The phenotype assigned were G6PD B (wild type), G6PD A (non-deficient type) and G6PD A− (deficient type).

PCR for molecular detection of Plasmodium species

Nested PCR was used for molecular detection of Plasmodium species as described [46, 47].

Briefly, a nested PCR was used to amplify species-specific sequences of the small sub-unit ribosomal ribonucleic acid (18S SSU rRNA) genes of P. falciparum. DNA from the culture of P. falciparum (3D7strain), DNA from blood samples of an individual never exposed to malaria, and PCR water were used as positive and negative controls and were included in each set of PCR for quality control. The PCR was carried out in a thermo-cycler (PTC-0240, The DNA engine® Thermal Cycler, Bio-Rad, Hercules, USA), followed by gel electrophoresis to determine whether blood sample was individuals as either parasite positive or negative.

Statistical analysis

Data were analysed using STATA (StataCorp, Texas, USA) software version 15 to generate the frequency and association tables. Frequency of parasite carriage was calculated as the sum of the number of individuals that were observed to be parasite positive over the total number of individuals. For categorical variables, Chi-squared or Fisher’s exact tests were used to assess significant differences in proportions when appropriate. All reported p-values are two-sided and were considered statistically significant if < 0.05. Logistic regression was used to fit analyses association of parasite carriage estimated by PCR (dependent variables) and G6PD genotype (independent variable). The relationship between G6PD genotype and phenotype was obtained using crosstabs descriptive statistics. Statistical significance was set at p value ≤ 0.05.

Results

Study participants

A total of 263 participants were recruited in the study, and 145 (55.1%) were female. The overall median age was 14 [interquartile range (IQR): 7–31] years (Table 1). Unfortunately, further demographic data was not collected such as data on weight and haemoglobin level.

Table 1 Distribution of study participants based on gender and age
Full size table

G6PD genotype distribution in the population

In this study, the enzymatic activity (phenotype) was not independently assessed to assign individuals either deficient or normal. However, based on genotype, individuals were assigned as normal, heterozygous, homozygous and hemizygous. Hence, with the exception of individuals who were assigned as normal, the rest of the individuals were termed as deficient although not all individuals termed as heterozygous will be deficient.

The overall G6PD deficiency in the study population was 16.4%. The study found that 8.0% (21/263) of those tested were G6PD deficiency heterozygous and 8.4% (22/263) were hemi/homozygous G6PD deficiency (Table 2). Among the hemi/homozygous G6PD deficiency, 54.5% (12/22) and 45.5% (10/22) were female and male, respectively.

Table 2 Genotype, allele frequency by village
Full size table

G6PD deficiency distribution by age group, sex and village

Among heterozygous individuals observed were found at the highest frequency (15.5%) among 5–14 years age and the highest carriage of heterozygous (18.2%) was at Mwaholo village and the lowest (3.6%) at Budutu village. However, the result reveals that there was no statistically significant difference in heterozygous G6PD deficiency carriage between villages and age (p > 0.05). For males hemizygote frequency was highest (17.7%) among those in age group 0–4 years and the highest carriage of G6PD hemizygote frequency (12.9%) was observed at Budutu village but all these were not statistically significant (p > 0.05) (Table 3). G6PD deficiency was higher (21.6%) among female compared to male (9.1%), observed difference was statistically significant (p = 0.007).

Table 3 G6PD genotype distribution among age group and village by sex
Full size table

G6PD deficiency and risk factors

The findings of this study showed that age group, village and gender were not associated with carriage of both G6PD deficiency heterozygous and G6PD deficiency hemo/hemizygous (p > 0.05) (Table 4).

Table 4 G6PD deficiency and risk factors for G6PD deficiency assessed
Full size table

Carriage of submicroscopic Plasmodium falciparum

Out of 248 samples analysed for submicroscopic parasites carriage, a total of 144 (58.1%) individuals were P. falciparum positive by PCR whereas a total of 25 samples (10.1%) and 3 samples (1.2%) were positive for P. malariae and P. ovale, respectively. None of the samples were positive for P. vivax. Furthermore, 16 (6.0%) samples were positive for both P. falciparum and P. malariae. Three samples (1.2%) were positive for both P. falciparum and P. ovale. None of the samples were positive for all P. falciparum, P. malariae and P. ovale.

In this study, there was no significant differences on submicroscopic P. falciparum carriage on G6PD homo/hemizygous deficiency and gender (p > 0.05). However, individuals with G6PD heterozygous deficiency were associated with carriage of submicroscopic P. falciparum (p = 0.029) (Table 5).

Table 5 Carriage of submicroscopic Plasmodium falciparum on G6PD deficiency, age, village and gender
Full size table

Discussion

This study describes and reports results of a cross-sectional study conducted in four villages of Misungwi district, Mwanza region, Tanzania. The main objective of this study was to map the distribution of G6PD deficiency in the study area, which is an important aspect of malaria control and elimination using primaquine.

In this study, the enzymatic activity (phenotype) to assign individuals either deficient or normal was not independently assessed. However, based on genotype individuals were assigned as normal, heterozygous, homozygous and hemizygous. Therefore, with the exception of individuals who were assigned as normal, the rest of the individuals were referred to deficient although not all individuals termed as heterozygous will be deficient. The study reveals that the prevalence of the G6PD deficiency is 16.4%, in which genotype frequency was 8.0% and 8.4% for female heterozygous, and male hemizygous/female homozygous respectively. The overall prevalence is very similar to what has been found elsewhere in sub-Saharan Africa, where it ranged from 0 to 25% [1, 48, 49] confirming that G6PD deficiency is common in malaria endemic areas. However, the interpretation of results on heterozygous individuals to be classified as either normal or deficient should be carefully considered in this study since enzymatic assessment of individuals was not carried out.

Unlike to a study which was carried out in Nigeria where high prevalence of G6PD deficiency was particularly among children 2–5 years old [50], there was no significant difference in prevalence of G6PD deficiency between age groups in this study. The result was similar to a study carried out in Nepal [51]. The reason for this difference is unknown. However, a study in Nigeria has attributed the high frequency of G6PD deficiency in children due to a high incidence of malaria parasitaemia in the area. In the current study area, a good number of individuals were having submicroscopic parasites.

Study in this area has indicated that over half of individuals have malaria in form of submicroscopic [5]. The observations on sub-microscopic parasitaemia is consistency to other findings of the studies carried out in North East Tanzania [4, 40] and other endemic countries [24], confirming that a large number of individuals are carrying sub-microscopic parasites in a malaria endemic area. Sub-microscopic parasites have been reported to contribute to malaria transmission in individuals similar to those individuals having microscopic gametocytes [52].

In this study, heterozygous G6PD deficiency was associated with carriage of submicroscopic parasites. It has already been reported in other studies that female heterozygotes are protected from severe malaria [53, 54], which can be explained by the fact that P. falciparum development is hindered in G6PD deficient red cells [24], slowing the rate of parasite replication and reducing the likelihood of severe disease [55]. However, the findings of this study on the association between G6PD deficiency and submicroscopic parasite carriage differs to a study carried out in Ghana where they found that G6PD deficiency was associated with a lower carriage of asymptomatic P. falciparum carriage in children aged between 6 and 12 years [56]. From the findings whether females are protected by G6PD deficiency is uncertain due to variation in study design, G6PD and to genetic differences between populations.

This high prevalence of G6PD deficiency in the area raises concern when planning for MDA for clearing of the malaria parasites in endemic areas using primaquine if a higher primaquine dose is considered [8, 57,58,59,60]. In the perspective of malaria elimination, the use of primaquine which is active against all liver stages of Plasmodium, and also offers activity against P. falciparum gametocytes, thereby blocking transmission to mosquitoes should be considered [58, 61].

Although studies in different malaria endemic countries including Tanzania [32, 62] have shown that SLDPQ is well tolerated and safe in G6PD deficiency it should be noted that higher PQ dosage are more effective and needed as indicated in Brazil [42] and Uganda [63]. Nevertheless, PQ at low dosage has been proved to be safe and successful when used as a partner drug to ACT [10, 31], but also it cannot be ignored that the proposed higher PQ dosage is associated with the risk of acute haemolytic anaemia [10, 64].

Tanzania is focusing on reducing malaria transmission and exploring the possibilities towards the malaria pre-elimination and elimination [38], the use of primaquine (SLDPQ or higher primaquine) dose will be an option. Therefore, studies on mapping G6PD deficiency in malaria hotspot area for MDA, taking into consideration of the dosage of PQ, would have provided further insight of G6PD deficiency in malaria hotspot area and help implementation of MDA [61]. Identification of remaining high-risk areas may become more important to understand G6PD distribution in other parts of the country which is very important for future malaria control and elimination and allowing resources to be targeted to areas that remain at high risk of malaria transmission.

This study has some limitations. The enzymatic activity was not assessed, haemoglobin level and other polymorphisms in the study area, and this is a topic which warrants future research.

Conclusion

G6PD deficiency is prevalent and spatially heterogeneous across in the study area. Likewise, submicroscopic infections, which are possible infectious reservoirs of parasites, are common in the area. The government of Tanzania is implementing recommended preventive and curative interventions to malaria with the possibility of moving towards the malaria elimination. One possibility is the use of primaquine, although SLDPQ is well tolerated and safe in G6PD deficiency, a higher PQ dosage may be needed. Higher dosage of PQ is associated with acute haemolytic anaemia in G6PD deficient individuals. Awareness is needed regarding the use of a higher dose of primaquine for G6PD deficiency individuals if required.

Availability of data and materials

The datasets in this study are available from the corresponding author on reasonable request.

Abbreviations

DHS:

Demographic and Health Survey

G6PD:

Glucose-6-phosphate dehydrogenase

HRP2:

histidine-rich protein 2

MDA:

Mass Drug Administration

RDT:

Malaria rapid diagnostic test

SNP:

Single nucleotide polymorphism

PCR:

Polymerase chain reaction

References

  1. Lavstsen T, Turner L, Saguti F, Magistrado P, Rask TS, Jespersen JS, et al. Plasmodium falciparum erythrocyte membrane protein 1 domain cassettes 8 and 13 are associated with severe malaria in children. Proc Natl Acad Sci USA. 2012;109:E1791–800.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  2. Alonso PL, Brown G, Arevalo-Herrera M, Binka F, Chitnis C, Collins F, et al. A research agenda to underpin malaria eradication. PLoS Med. 2011;8: e1000406.

    Article  PubMed Central  PubMed  Google Scholar 

  3. Tanner M, Greenwood B, Whitty CJ, Ansah EK, Price RN, Dondorp AM, et al. Malaria eradication and elimination: views on how to translate a vision into reality. BMC Med. 2015;13:167.

    Article  PubMed Central  PubMed  Google Scholar 

  4. Manjurano A, Okell L, Lukindo T, Reyburn H, Olomi R, Roper C, et al. Association of sub-microscopic malaria parasite carriage with transmission intensity in north-eastern Tanzania. Malar J. 2011;10:370.

    Article  PubMed Central  PubMed  Google Scholar 

  5. Mosha JF, Sturrock HJ, Greenwood B, Sutherland CJ, Gadalla NB, Atwal S, et al. Hot spot or not: a comparison of spatial statistical methods to predict prospective malaria infections. Malar J. 2014;13:53.

    Article  PubMed Central  PubMed  Google Scholar 

  6. Stresman GH, Stevenson JC, Ngwu N, Marube E, Owaga C, Drakeley C, et al. High levels of asymptomatic and subpatent Plasmodium falciparum parasite carriage at health facilities in an area of heterogeneous malaria transmission intensity in the Kenyan highlands. Am J Trop Med Hyg. 2014;91:1101–8.

    Article  PubMed Central  PubMed  Google Scholar 

  7. Bousema T, Okell L, Felger I, Drakeley C. Asymptomatic malaria infections: detectability, transmissibility and public health relevance. Nat Rev Microbiol. 2014;12:833–40.

    Article  CAS  PubMed  Google Scholar 

  8. White NJ, Qiao LG, Qi G, Luzzatto L. Rationale for recommending a lower dose of primaquine as a Plasmodium falciparum gametocytocide in populations where G6PD deficiency is common. Malar J. 2012;11:418.

    Article  PubMed Central  PubMed  Google Scholar 

  9. Bousema T, Eziefula AC, Pett H, Drakeley C. Low-dose primaquine for falciparum malaria. Lancet Infect Dis. 2014;14:677.

    Article  PubMed  Google Scholar 

  10. WHO. Policy brief on single dose primaquine as a gametocytocide in Plasmodium falciparum malaria. Geneva: World Health Organization; 2014. https://www.who.int/publications/i/item/WHO-HTM-GMP-2015.1. Accessed 22 Oct 2023.

  11. WHO. Guidelines for the treatment of malaria. Geneva: World Health Organization; 2023.

    Google Scholar 

  12. Shekalaghe SA, ter Braak R, Daou M, Kavishe R, van den Bijllaardt W, van den Bosch S, et al. In Tanzania, hemolysis after a single dose of primaquine coadministered with an artemisinin is not restricted to glucose-6-phosphate dehydrogenase-deficient (G6PD A−) individuals. Antimicrob Agents Chemother. 2010;54:1762–8.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  13. Kuwahata M, Wijesinghe R, Ho MF, Pelecanos A, Bobogare A, Landry L, et al. Population screening for glucose-6-phosphate dehydrogenase deficiencies in Isabel Province, Solomon Islands, using a modified enzyme assay on filter paper dried bloodspots. Malar J. 2010;9: 223.

    Article  PubMed Central  PubMed  Google Scholar 

  14. Nkhoma ET, Poole C, Vannappagari V, Hall SA, Beutler E. The global prevalence of glucose-6-phosphate dehydrogenase deficiency: a systematic review and meta-analysis. Blood Cells Mol Dis. 2009;42:267–78.

    Article  CAS  PubMed  Google Scholar 

  15. Minucci A, Moradkhani K, Hwang MJ, Zuppi C, Giardina B, Capoluongo E. Glucose-6-phosphate dehydrogenase (G6PD) mutations database: review of the old and update of the new mutations. Blood Cells Mol Dis. 2012;48:154–65.

    Article  CAS  PubMed  Google Scholar 

  16. Hirono A, Beutler E. Molecular cloning and nucleotide sequence of cDNA for human glucose-6-phosphate dehydrogenase variant A(−). Proc Natl Acad Sci USA. 1988;85:3951–4.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  17. Enevold A, Vestergaard LS, Lusingu J, Drakeley CJ, Lemnge MM, Theander TG, et al. Rapid screening for glucose-6-phosphate dehydrogenase deficiency and haemoglobin polymorphisms in Africa by a simple high-throughput SSOP-ELISA method. Malar J. 2005;4: 61.

    Article  PubMed Central  PubMed  Google Scholar 

  18. von Seidlein L, Auburn S, Espino F, Shanks D, Cheng Q, McCarthy J, et al. Review of key knowledge gaps in glucose-6-phosphate dehydrogenase deficiency detection with regard to the safe clinical deployment of 8-aminoquinoline treatment regimens: a workshop report. Malar J. 2013;12: 112.

    Article  Google Scholar 

  19. Ruwende C, Khoo SC, Snow RW, Yates SN, Kwiatkowski D, Gupta S, et al. Natural selection of hemi- and heterozygotes for G6PD deficiency in Africa by resistance to severe malaria. Nature. 1995;376:246–9.

    Article  CAS  PubMed  Google Scholar 

  20. Beutler E. G6PD: population genetics and clinical manifestations. Blood Rev. 1996;10:45–52.

    Article  CAS  PubMed  Google Scholar 

  21. Vulliamy T, Mason P, Luzzatto L. The molecular basis of glucose-6-phosphate dehydrogenase deficiency. Trends Genet. 1992;8:138–43.

    Article  CAS  PubMed  Google Scholar 

  22. Guindo A, Fairhurst RM, Doumbo OK, Wellems TE, Diallo DA. X-linked G6PD deficiency protects hemizygous males but not heterozygous females against severe malaria. PLoS Med. 2007;4:e66.

    Article  PubMed Central  PubMed  Google Scholar 

  23. Mosha JF, Sturrock HJ, Greenhouse B, Greenwood B, Sutherland CJ, Gadalla N, et al. Epidemiology of subpatent Plasmodium falciparum infection: implications for detection of hotspots with imperfect diagnostics. Malar J. 2013;12:221.

    Article  PubMed Central  PubMed  Google Scholar 

  24. Okell LC, Ghani AC, Lyons E, Drakeley CJ. Submicroscopic infection in Plasmodium falciparum-endemic populations: a systematic review and meta-analysis. J Infect Dis. 2009;200:1509–17.

    Article  PubMed  Google Scholar 

  25. Bwayo D, Kaddumukasa M, Ddungu H, Kironde F. Prevalence of glucose-6-phosphate dehydrogenase deficiency and its association with Plasmodium falciparum infection among children in Iganga district in Uganda. BMC Res Notes. 2014;7:372.

    Article  PubMed Central  PubMed  Google Scholar 

  26. malERA Refresh Consultative Panel on Characterising the Reservoir and Measuring Transmission. malERA: an updated research agenda for characterising the reservoir and measuring transmission in malaria elimination and eradication. PLoS Med. 2017;14:e1002452.

    Article  Google Scholar 

  27. Fanello CI, Karema C, Avellino P, Bancone G, Uwimana A, Lee SJ, et al. High risk of severe anaemia after chlorproguanil-dapsone + artesunate antimalarial treatment in patients with G6PD (A−) deficiency. PLoS ONE. 2008;3:e4031.

    Article  PubMed Central  PubMed  Google Scholar 

  28. White NJ. The role of anti-malarial drugs in eliminating malaria. Malar J. 2008;7(Suppl 1):8.

    Article  Google Scholar 

  29. Kaneko A, Taleo G, Kalkoa M, Yamar S, Kobayakawa T, Bjorkman A. Malaria eradication on islands. Lancet. 2000;356:1560–4.

    Article  CAS  PubMed  Google Scholar 

  30. Hill DR, Baird JK, Parise ME, Lewis LS, Ryan ET, Magill AJ. Primaquine: report from CDC expert meeting on malaria chemoprophylaxis I. Am J Trop Med Hyg. 2006;75:402–15.

    Article  CAS  PubMed  Google Scholar 

  31. Raman J, Allen E, Workman L, Mabuza A, Swanepoel H, Malatje G, et al. Safety and tolerability of single low-dose primaquine in a low-intensity transmission area in South Africa: an open-label, randomized controlled trial. Malar J. 2019;18:209.

    Article  PubMed Central  PubMed  Google Scholar 

  32. Shekalaghe S, Mosha D, Hamad A, Mbaga TA, Mihayo M, Bousema T, et al. Optimal timing of primaquine to reduce Plasmodium falciparum gametocyte carriage when co-administered with artemether–lumefantrine. Malar J. 2020;19:34.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  33. Eziefula AC, Pett H, Grignard L, Opus S, Kiggundu M, Kamya MR, et al. Glucose-6-phosphate dehydrogenase status and risk of hemolysis in Plasmodium falciparum-infected African children receiving single-dose primaquine. Antimicrob Agents Chemother. 2014;58:4971–3.

    Article  PubMed Central  PubMed  Google Scholar 

  34. Chen I, Poirot E, Newman M, Kandula D, Shah R, Hwang J, et al. An assessment of the supply, programmatic use, and regulatory issues of single low-dose primaquine as a Plasmodium falciparum gametocytocide for sub-Saharan Africa. Malar J. 2015;14:204.

    Article  PubMed Central  PubMed  Google Scholar 

  35. Galappaththy GN, Omari AA, Tharyan P. Primaquine for preventing relapses in people with Plasmodium vivax malaria. Cochrane Database Syst Rev. 2007;1:CD004389.

    Google Scholar 

  36. Baird JK, Rieckmann KH. Can primaquine therapy for vivax malaria be improved? Trends Parasitol. 2003;19:115–20.

    Article  CAS  PubMed  Google Scholar 

  37. Eziefula AC, Bousema T, Yeung S, Kamya M, Owaraganise A, Gabagaya G, et al. Single dose primaquine for clearance of Plasmodium falciparum gametocytes in children with uncomplicated malaria in Uganda: a randomised, controlled, double-blind, dose-ranging trial. Lancet Infect Dis. 2014;14:130–9.

    Article  CAS  PubMed  Google Scholar 

  38. MoH. Tanzania demographic and health survey and malaria indicator survey (TDHS-MIS) 2015–16. Dar es Salaam, Tanzania. 2015.

  39. Mosha JF, Sturrock HJ, Brown JM, Hashim R, Kibiki G, Chandramohan D, et al. The independent effect of living in malaria hotspots on future malaria infection: an observational study from Misungwi, Tanzania. Malar J. 2014;13: 445.

    Article  PubMed Central  PubMed  Google Scholar 

  40. Shekalaghe SA, Bousema JT, Kunei KK, Lushino P, Masokoto A, Wolters LR, et al. Submicroscopic Plasmodium falciparum gametocyte carriage is common in an area of low and seasonal transmission in Tanzania. Trop Med Int Health. 2007;12:547–53.

    Article  PubMed  Google Scholar 

  41. Ouedraogo AL, Bousema T, Schneider P, de Vlas SJ, Ilboudo-Sanogo E, Cuzin-Ouattara N, et al. Substantial contribution of submicroscopical Plasmodium falciparum gametocyte carriage to the infectious reservoir in an area of seasonal transmission. PLoS ONE. 2009;4: e8410.

    Article  PubMed Central  PubMed  Google Scholar 

  42. de Pina-Costa A, Silvino ACR, Dos Santos EM, Pedro RS, Moreira J, Umana GL, et al. Increased primaquine total dose prevents Plasmodium vivax relapses in patients with impaired CYP2D6 activity: report of three cases. Malar J. 2021;20:341.

    Article  PubMed Central  PubMed  Google Scholar 

  43. O’Meara WP, Mangeni JN, Steketee R, Greenwood B. Changes in the burden of malaria in sub-Saharan Africa. Lancet Infect Dis. 2010;10:545–55.

    Article  PubMed  Google Scholar 

  44. Segeja MD, Mmbando BP, Kamugisha ML, Akida JA, Savaeli ZX, Minja DT, et al. Prevalence of glucose-6-phosphate dehydrogenase deficiency and haemoglobin S in high and moderate malaria transmission areas of Muheza, north-eastern Tanzania. Tanzan J Health Res. 2008;10:9–13.

    Article  CAS  PubMed  Google Scholar 

  45. WHO Working Group. Glucose-6-phosphate dehydrogenase deficiency. Bull World Health Organ. 1989;67:601–11.

    Google Scholar 

  46. Snounou G, Viriyakosol S, Jarra W, Thaithong S, Brown KN. Identification of the four human malaria parasite species in field samples by the polymerase chain reaction and detection of a high prevalence of mixed infections. Mol Biochem Parasitol. 1993;58:283–92.

    Article  CAS  PubMed  Google Scholar 

  47. Snounou G, Viriyakosol S, Zhu XP, Jarra W, Pinheiro L, do Rosario VE, et al. High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol Biochem Parasitol. 1993;61:315–20.

    Article  CAS  PubMed  Google Scholar 

  48. Galatas B, Mabote L, Simone W, Matambisso G, Nhamussua L, Manu-Pereira MD, et al. Heterogeneity of G6PD deficiency prevalence in Mozambique: a school-based cross-sectional survey in three different regions. Malar J. 2017;16:36.

    Article  PubMed Central  PubMed  Google Scholar 

  49. Howes RE, Piel FB, Patil AP, Nyangiri OA, Gething PW, Dewi M, et al. G6PD deficiency prevalence and estimates of affected populations in malaria endemic countries: a geostatistical model-based map. PLoS Med. 2012;9: e1001339.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  50. Isaac I, Mainasara A, Erhabor O, Omojuyigbe S, Dallatu M, Bilbis L, et al. Glucose-6-phosphate dehydrogenase deficiency among children attending the Emergency Paediatric Unit of Usmanu Danfodiyo University Teaching Hospital, Sokoto, Nigeria. Int J Gen Med. 2013;6:557–62.

    CAS  PubMed Central  PubMed  Google Scholar 

  51. Ghimire P, Singh N, Ortega L, Rijal KR, Adhikari B, Thakur GD, et al. Glucose-6-phosphate dehydrogenase deficiency in people living in malaria endemic districts of Nepal. Malar J. 2017;16:214.

    Article  PubMed Central  PubMed  Google Scholar 

  52. Schneider P, Bousema JT, Gouagna LC, Otieno S, van de Vegte-Bolmer M, Omar SA, et al. Submicroscopic Plasmodium falciparum gametocyte densities frequently result in mosquito infection. Am J Trop Med Hyg. 2007;76:470–4.

    Article  PubMed  Google Scholar 

  53. Manjurano A, Sepulveda N, Nadjm B, Mtove G, Wangai H, Maxwell C, et al. African glucose-6-phosphate dehydrogenase alleles associated with protection from severe malaria in heterozygous females in Tanzania. PLoS Genet. 2015;11: e1004960.

    Article  PubMed Central  PubMed  Google Scholar 

  54. Uyoga S, Ndila CM, Macharia AW, Nyutu G, Shah S, Peshu N, et al. Glucose-6-phosphate dehydrogenase deficiency and the risk of malaria and other diseases in children in Kenya: a case–control and a cohort study. Lancet Haematol. 2015;2:e437–44.

    Article  PubMed Central  PubMed  Google Scholar 

  55. Luzzatto L, Usanga FA, Reddy S. Glucose-6-phosphate dehydrogenase deficient red cells: resistance to infection by malarial parasites. Science. 1969;164:839–42.

    Article  CAS  PubMed  Google Scholar 

  56. Amoah LE, Opong A, Ayanful-Torgby R, Abankwa J, Acquah FK. Prevalence of G6PD deficiency and Plasmodium falciparum parasites in asymptomatic school children living in southern Ghana. Malar J. 2016;15:388.

    Article  PubMed Central  PubMed  Google Scholar 

  57. Cappellini MD, Fiorelli G. Glucose-6-phosphate dehydrogenase deficiency. Lancet. 2008;371:64–74.

    Article  CAS  PubMed  Google Scholar 

  58. Shekalaghe S, Drakeley C, Gosling R, Ndaro A, van Meegeren M, Enevold A, et al. Primaquine clears submicroscopic Plasmodium falciparum gametocytes that persist after treatment with sulphadoxine–pyrimethamine and artesunate. PLoS ONE. 2007;2:e1023.

    Article  PubMed Central  PubMed  Google Scholar 

  59. White NJ. Primaquine to prevent transmission of falciparum malaria. Lancet Infect Dis. 2013;13:175–81.

    Article  CAS  PubMed  Google Scholar 

  60. Ashley EA, Recht J, White NJ. Primaquine: the risks and the benefits. Malar J. 2014;13: 418.

    Article  PubMed Central  PubMed  Google Scholar 

  61. Okebe J, Bousema T, Affara M, Di Tanna GL, Dabira E, Gaye A, et al. The gametocytocidal efficacy of different single doses of primaquine with dihydroartemisinin-piperaquine in asymptomatic parasite carriers in the Gambia: a randomized controlled trial. EBioMedicine. 2016;13:348–55.

    Article  PubMed Central  PubMed  Google Scholar 

  62. Mwaiswelo RO, Ngasala B, Msolo D, Kweka E, Mmbando BP, Martensson A. A single low dose of primaquine is safe and sufficient to reduce transmission of Plasmodium falciparum gametocytes regardless of cytochrome P450 2D6 enzyme activity in Bagamoyo district, Tanzania. Malar J. 2022;21:84.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  63. Ali A, Wallender E, Hughes E, Dorsey G, Savic RM. Interplay among malnutrition, chemoprevention, and the risk of malaria in young Ugandan children: longitudinal pharmacodynamic and growth analysis. CPT Pharmacomet Syst Pharmacol. 2023;12:656–67.

    Article  CAS  Google Scholar 

  64. Pamba A, Richardson ND, Carter N, Duparc S, Premji Z, Tiono AB, et al. Clinical spectrum and severity of hemolytic anemia in glucose 6-phosphate dehydrogenase-deficient children receiving dapsone. Blood. 2012;120:4123–33.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We thank Dr. Steven Mwakalinga for his contribution to the study. We are indebted to all the participants of this study. We are also akin to thank the all staff of National Institute for Medical Research/Mwanza Intervention Trials Unit for their help.

Funding

This work was supported by Training Health Researchers into Vocational Excellence in East Africa (THRiVE), grant number 087540 funded by the Wellcome Trust. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the supporting offices.

Author information

Authors and Affiliations

  1. Mwanza Centre, National Institute for Medical Research, Mwanza, Tanzania

    Alphaxard Manjurano, Eric Lyimo, Coleman Kishamawe, Jacklin Mosha, Miyaye Donald & John Changalucha

  2. Mabibo Centre, National Institute for Medical Research, Dar es Salaam, Tanzania

    Justin Omolo & Paul Kazyoba

  3. Mwanza Intervention Trials Unit, National Institute for Medical Research, Mwanza, Tanzania

    Saidi Kapiga & John Changalucha

  4. Department of Infectious Disease Epidemiology, London School of Hygiene and Tropical Medicine, London, UK

    Saidi Kapiga

Authors
  1. Alphaxard Manjurano
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Eric Lyimo
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Coleman Kishamawe
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Justin Omolo
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Jacklin Mosha
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Miyaye Donald
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Paul Kazyoba
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Saidi Kapiga
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. John Changalucha
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

AM and JM designed the study. JM, JC, AM, PK and SK were responsible for study participants recruitment, clinical and parasitological examinations and supervision of the study. AM, EL and DM did the genotyping, and CK, AM and JO analyzed and interpreted the data. AM and EL wrote the first draft with major contributions of the other authors. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Alphaxard Manjurano.

Ethics declarations

Ethics approval and consent to participate

Ethical approval was obtained from the Lake Zone Institutional Review board (LZIRB), National Institute for Medical Research, Tanzania (MR/53/100/287).

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Manjurano, A., Lyimo, E., Kishamawe, C. et al. Prevalence of G6PD deficiency and submicroscopic malaria parasites carriage in malaria hotspot area in Northwest, Tanzania. Malar J 22, 372 (2023). https://doi.org/10.1186/s12936-023-04801-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12936-023-04801-1

Keywords

Malaria Journal

ISSN: 1475-2875

Contact us