Open Access

Comparative analysis of the profiles of IgG subclass-specific responses to Plasmodium falciparum apical membrane antigen-1 and merozoite surface protein-1 in naturally exposed individuals living in malaria hypoendemic settings, Iran

  • Maryam Rouhani1,
  • Sedigheh Zakeri1Email author,
  • Akram A Mehrizi1 and
  • Navid D Djadid1
Malaria Journal201514:58

https://doi.org/10.1186/s12936-015-0547-0

Received: 9 September 2014

Accepted: 6 January 2015

Published: 5 February 2015

Abstract

Background

Plasmodium falciparum apical membrane antigen-1 (PfAMA-1) and the 19-kDa C-terminal region of merozoite surface protein-1 (PfMSP-119) are candidate malaria vaccine antigens expressed on merozoites and sporozoites. This investigation was performed to evaluate simultaneously the naturally-acquired antibodies to PfAMA-1 and PfMSP-119 and to compare IgG subclass profiles to both antigens in naturally exposed individuals living in malaria hypoendemic areas in Iran to determine which antigen has better ability to detect sero-positive individuals infected with P. falciparum.

Methods

In this investigation, 101 individuals from the malaria-endemic areas in Iran were examined. PfAMA-1 and PfMSP-119 were expressed in Escherichia coli, and IgG isotype composition of naturally acquired antibodies to the antigens (as single or in combination) was measured by ELISA assay.

Results

The result showed that 87.1% and 84.2% of the studied individuals had positive anti-PfAMA-1 and -PfMSP-119 IgG antibody responses, respectively, and the prevalence of responders did not differ significantly (P > 0.05). Moreover, IgG1 and IgG3 were predominant over IgG2 and IgG4 antibodies and the prevalence of IgG and its subclasses to two tested antigens had no significant correlation with age and exposure (P > 0.05). The present data confirmed that when recombinant PfAMA-1 and recombinant PfMSP-119 antigens were combined in ELISA at equal ratios of 200 ng (100 ng each antigen/well) and 400 ng (200 ng each antigen/well), 86.1% and 87.1% of positives sera were detected among the examined samples, respectively.

Conclusions

The two tested recombinant antigens are immunogenic molecules, and individuals in low transmission areas in Iran could develop and maintain equal immune responses to PfAMA-1 and PfMSP-119. Therefore, these results could support the design of a universal PfAMA-1- and PfMSP-119-based vaccine. Also, both recombinant antigens could be used in combination as reliable serology markers to perform immuno-epidemiological studies in malaria-endemic areas of Iran during elimination strategy. The present information could be of use in control and elimination programmes in Iran and other similar malaria settings.

Keywords

Malaria P. falciparum AMA-1 MSP-119 Sero-epidemiology Vaccine

Background

Malaria is caused by different obligate intracellular parasites. Plasmodium falciparum is one the most lethal species of malaria parasites that infects humans [1]. This parasite species is responsible for most of the pathology associated with the disease [2]. The unacceptable health burden of malaria and its economical and social impacts have led to making a plan for scaling-up malaria control, elimination, and global eradication [3]. However, the hopes of achieving this goal are diminishing due to the limited effective control tools, the emergence and rapid widespread occurrence of drug-resistant parasites, and the resistance of mosquitoes to insecticides.

Therefore, a search for new tools is required to control or eliminate malaria. One of the effective tools to combat infectious diseases is vaccination [4]. Hence, to design an efficient malaria vaccine, it is essential to determine the key target antigen that induces protective immunity for applying in vaccine development [5].

Immuno-epidemiological studies in diverse malaria-endemic regions with different level of transmission and human genetic background provide more information to understand the host immune response to P. falciparum, and also it may help to design an effective vaccine against this species. For instance, individuals who are living in endemic areas are simultaneously and repeatedly challenged with numerous malaria antigens. In high transmission regions, all individuals have many infections during their life; therefore, protective immunity develops with age/exposure in these individuals [6]. In contrast, in low and unstable transmission regions, there is a lack of such correlation with age [7-12].

A passive transfer study conducted in the 1960s showed that IgG antibody is a major component of naturally-acquired protective immune responses of P. falciparum [13,14]. In malaria-endemic areas, older children and adults develop naturally-acquired immunity to malaria but remain susceptible to infection.

In the life cycle of human malaria parasites, the invasion of erythrocytes by merozoites (the only extracellular stage of the asexual cycle) is an obligatory step during blood-stage infection, and blocking this step with antibodies would lead to hinder the invasion of red blood cells [13,15,16]. The proteins that are present on the surface of invasive merozoites of Plasmodium are essential targets for development of an effective malaria vaccine. Among them, merozoite surface protein-1 (MSP-1) and apical membrane antigen-1 (AMA-1) are considered leading and attractive malaria blood-stage vaccine candidate antigens [17-21]. These two antigens are located on the merozoite surface and undergo proteolytic processing before the invasion of merozoite into the red blood cells.

AMA-1 is a type I integral membrane protein expressed on merozoites and sporozoites and initially located in the micronemes [22-25]. AMA-1 is synthesized in segmenting schizonts as an 83-kDa precursor protein. At about the time of merozoite release and erythrocyte invasion, the prodomain is cleaved to a 66 kDa membrane-bound form [26,27], where it is subsequently shed as 44- and 48-kDa forms [27,28]. This protein has three subdomains defined by their disulfide bonds [29] and contains 16 conserved cysteine residues forming eight intra molecular disulfide bonds [26]. Furthermore, individuals living in areas where malaria is endemic have antibodies against AMA-1 [30-32], and these antibodies efficiently inhibit the process of red blood cells invasion in vitro [28,31,33]. The protective efficacy of AMA-1-based vaccines against parasite challenge has been demonstrated in many rodent and monkey models [22,34,35].

MSP-1 is synthesized as a 195-kDa protein and sequentially processed into a cysteine-rich 19-kDa fragment (MSP-119) [36]. This protein contains two epidermal growth factor (EGF)-like domains [37,38]. Several in vitro and in vivo studies have shown that the PfMSP-119 is an ideal target for blocking parasite invasion into the erythrocyte [39-43]. Antibodies to PfMSP-119 are found in the majority of malaria-exposed individuals from endemic areas [44,45], and these antibodies correlate with the development of clinical immunity against P. falciparum malaria [44,46].

In Iran, malaria is hypoendemic with seasonal transmission. In 2013, due to elimination strategies, about 1,373 malaria cases were reported from Iran that more than 80% of these cases were Plasmodium vivax and the rest of them were P. falciparum (the Ministry of Health, 2013, unpublished). In this area, there is no record of severe malaria or death due to malaria. Most of the patients are adults and may experience several infections by P. falciparum and P. vivax with clinical symptoms. As a continuation of the previous immuno-epidemiological studies in Iran [10,11,47-49], in the present study, the main objective was to evaluate simultaneously the naturally acquired antibodies responses to two recombinant proteins of P. falciparum (PfMSP-119 and PfAMA-1) among falciparum malaria subjects in the hypoendemic areas of Iran.

These two antigens were selected for this study because the evidence showed that there is likely a association between the presence of antibodies to these antigens and protection [50,51]. In fact, it demonstrates that both antigens are potential asexual erythrocytic stage vaccine candidates. Therefore, the main objective of the present work was to evaluate and compare the profile of IgG subclass-specific responses to PfAMA-1 and PfMSP-119 in naturally exposed individuals living in the malaria hypoendemic areas, Iran. Also, the association between naturally acquired anti-PfAMA-1 and -PfMSP-119 isotype responses and host age and exposure was assessed in this study. Furthermore, as both target antigens are used as a mean of detection of antibody responses in areas of low endemicity [52-55]; therefore, the second objective of the present study was to determine which antigen has better ability to detect sero-positive individuals infected with P. falciparum. The current information could be of value for control and elimination programmes in areas of low endemicity.

Methods

Study area, subjects, and blood sample collection

This study was carried out in Chabahar, Sistan and Baluchistan Province in south-eastern Iran. In this area, most of the patients are adults and may experience several infections by P. falciparum and P. vivax. In this investigation, 101 blood samples were obtained from suspected patients attended at the Malaria Health Center in Chabahar Public Health Department in Sistan and Baluchistan Province from May 2006 to 2012. Before blood collection, an informed consent was obtained from adults or parents or legal guardians of children who were participant in this study. The diagnosis of malaria was made by microscopic examination of blood smears stained with Giemsa. All P. falciparum-positive samples were verified by molecular diagnosis using the 18ssrRNA gene as described previously [56]. The control blood samples (n = 30) were obtained from the residents in Tehran (Iran) with no known pervious exposure to malaria. From all subjects, 2 ml venous blood was collected for both Plasmodium DNA detection and serum collection in EDTA tubes. The collected blood samples were transported on-ice to the main laboratory in the Institut Pasteur Iran. The majority of the patients were male (75.2%) with a mean age of 29.9 ± 12.6 years (ranged between 4 to 75 years old). The patients’ travel histories were obtained by a physician prior to sampling. The demographic information of the examined groups is shown in Table 1. This study was approved by the Ethical Review Committee of Research in Institut Pasteur Iran.
Table 1

Demographic characteristics of the examined subjects in this study

Mean age ± SD

Sex (%)

Exposure (%)

Nationality (%)

Travel history (%)

Male

Female

First exposure

More than one exposure

Iranian

Pakistani

Afghani

Yes

No

29.9 ± 12.6

75.2

24.8

48.5%

51.5%

48.5

44.5

6.9

49.5

50.5

Cloning and sub-cloning of PfAMA-1

Parasite genomic DNA was prepared from the whole blood by using the commercially available DNA Purification Kit (Promega, Madison, WI, USA). The DNA was dissolved in 30 μl TE buffer (10 mM Tris–HCl, pH 8.0, 0.1 mM EDTA) and kept at −20°C until use. In this study, for the expression of recombinant PfAMA-1 (rPfAMA-1), DNA samples with known sequences of PfAMA-1 (GenBank accession no. KC413989) were selected based on previous study [57]. Amplification of PfAMA-1 fragment corresponding to amino acids 96–542 (nucleotides: 286–1626) was performed using the following primers:

PfAMA-1-AF:AGCGGAGGATCCAGCATTGAAATAGTAGAAAGAAG, BamHI site (italic)

PfAMA-1-AR: AGGGCCAAGCTTCATAAGTTGGTTTATGTTCAG, HindIII site (italic)

The PCR was performed at 95°C for 5 min, 30 cycles at 94°C for 1 min, 60°C for 1 min, 72°C for 1 min, followed by 60°C for 2 min and final extension at 72°C for 30 min. The PCR products were analysed by electrophoresis on 1% agarose gel under an ultraviolet light and purified by QIA quick Gel Extraction Kit (Qiagen, Germany). The gel-purified PCR products were cloned into pGEM-T Easy Vector (Promega, USA) and transformed into Escherichia coli DH5α. The transformed clones were selected on the Luria-Bertani agar medium, containing 100 μg/ml ampicillin, 1.5 mM isopropyl-β-D-thiogalactopyranoside (IPTG), and 0.04% X-gal. Positive clones were confirmed by plasmid isolation, followed by digestion with EcoRI, and the cloned fragments were then sequenced. Fragments corresponding to the PfAMA-1 sequence were excised with restriction enzymes (BamHI and HindIII) and ligated to the BamHI-HindIII sites of vector pQE-30 (Qiagen, Germany), which provides a poly-histidine (6-His) tag in N-terminus to facilitate further purification. The ligation mixtures were transformed into competent E. coli DH5α cells, and the recombinant clones were selected on ampicillin plates. The open reading frame was confirmed by sequencing, and this construct was used to transform E. coli M15 (pREP4) expression host (Qiagen, Germany).

Expression and purification of rPfAMA-1

rPfAMA-1 was expressed in E. coli M15. Briefly, overnight cultures from single colonies of PfAMA-1-specific E. coli were expanded in TB (Terrific broth; pH 7.2), containing ampicillin (100 μg/ml) and kanamycin (25 μg/ml) with shaking (150 rpm) at 37°C until an optical density (OD) of 0.6 to 0.7 at 600 nm was reached. The expression of PfAMA-1 was induced with 0.5 mM IPTG (Sigma, USA). The culture was further grown for 4 h, and the E. coli cells were harvested by centrifugation and kept in −80°C until use. PfAMA-1 was expressed in inclusion bodies, and the cell pellet was dissolved in denaturation buffer (8 M Urea, 30 mM imidazole, 20 mM Tris–HCl, and 1 M NaCl, pH 7.9). The cells were lysed on ice by sonication (Ultraschallprozessor, Germany) with 10 cycles, each consisting of 20- second (s) pulses with 20-s intervals. The bacterial lysate was centrifuged at 14,000 × rpm at 4°C for 30 min. The supernatant was incubated with Ni2+-nitrilotriacetic acid agarose resin (Ni-NTA Agarose, Qiagen, Germany) at 4°C for 2 h, and the resin was packed into a column and was washed with a 10-column volume of wash buffer (6 M urea, 20 mMTris-HCl, 1 M NaCl, and 60 mM imidazole, pH 7.9). The bound protein was eluted with a buffer, containing 4 M urea, 200 mM imidazole, 20 mM Tris–HCl, and 300 mM NaCl, pH 7.9. The fractions containing PfAMA-1 was desalted with Econo-Pac 10DG columns (BioRad, USA) according to the manufacture’s manual and then concentrated with a concentrator (Eppendorf, Germany). The eluted proteins were analysed under reducing (with 1% SDS and 2% β-mercaptoethanol [2ME]) and non-reducing conditions (with SDS and without 2ME) by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, 12%). The concentration of the protein was determined using Bradford’s assay by a spectrophotometer (Eppendorf, Germany). To confirm the purified recombinant proteins, Western blot assay was carried out by standard protocols using anti-His antibody (Penta His Antibody; Qiagen) and with P. falciparum-infected human sera that reacted with rPfAMA-1 under both reducing and non-reducing conditions. Protein migration at different sizes on SDS-PAGE in the presence and absence of 2ME indicates the presence of a disulfide bound, suggesting that all recombinant proteins had a tertiary shape in their antigens.

Expression and purification of recombinant PfMSP-119 (rPfMSP-119)

rPfMSP-119 was expressed as described previously [11]. Briefly, rPfMSP-119 protein was expressed in E. coli BL21. Overnight cultures from single colonies of PfMSP-119− specific E. coli were expanded in TB (pH 7.2) containing ampicillin (100 μg/ml) at 37°C with shaking (150 rpm) until an OD of 0.6-0.7 at 600 nm was reached. In addition, the expression of GST-PfMSP-119 was induced with 0.5 mM IPTG (Sigma, USA). The culture was further grown for 4 h, and the E. coli cells were harvested by centrifugation and kept in −70°C until use. The cell pellet was dissolved in PBS 1× (pH 7.4) and lysed on ice with 10 sonication cycles (Ultraschall-Prozessor, Germany), each consisting of 20-s pulses at 20-s intervals. The bacterial lysate was centrifuged at 14,000 × g at 4°C for 30 min. The supernatant was incubated with glutathione 4B Sepharose resin (Amersham Biosciences, USA) at 4°C for 1 h, and the resin was packed into a column. The column was washed with PBS 1×, pH 7.4 (10-column volume). The bound protein was eluted with a buffer, containing 50 mM Tris–HCl and 10 mM reduced glutathione, pH 8. The fractions containing PfMSP-119 were desalted with Econo-Pac 10 DG columns (BioRad, USA) according to the manufacturer’s manual and then concentrated with a concentrator (Eppendorf, Germany). The eluted proteins were analysed under reducing (with 1% SDS and 2% 2ME) and non-reducing conditions (with SDS and without 2ME) by SDS-PAGE (12%), and the concentration of the protein was determined using Bradford's assay by a spectrophotometer (Eppendorf, Germany).

Mice immunization

Inbred BALB⁄c female mice (6–8 weeks old) were obtained from Laboratory Animal Science Department, the Institut Pasteur Iran. Mice groups (n = 7) were immunized subcutaneously at the base of tail with 30 μg and 35 μg of the rPfAMA-1and rPfMSP-119, respectively. In priming and boosting, the antigens were then emulsified in complete Freund's adjuvant (CFA, Sigma, St. Louis, MO, USA) and with incomplete Freund's adjuvant (IFA, Sigma) in 1:1 ratio. The mice control groups were immunized with PBS alone, PBS in Freund's adjuvant and rGST alone. The animals were boosted on days 14 and 28 and bled on days 0 (pre-immune), 21, and 35 of first immunization.

Indirect immunofluorescence antibody test (IFAT)

IFAT assay was performed to test the ability of the anti-PfAMA-1 and anti-PfMSP-119 sera of immunized mice, to recognize the native form of both antigens on merozoite surface and to determine the similarity between epitopes in recombinant forms and corresponding native proteins. For this purpose, multispot slides of parasites were prepared from P. falciparum culture, air-dried and then fixed in cold acetone for 10 min. Polyclonal mouse sera diluted (1:100–1:12,800) in PBS were added to the spots and incubated in a wet chamber for 60 min. After washing three times with PBS (pH 7.4), each well was covered with 20 μL of the fluorescein-conjugated anti-mouse polyvalent IgG (1:40) and then left in a wet chamber for 40 min. Again, after washing three times with PBS, coverslips were placed on each slide and examined under a fluorescence microscope (Nikon E200, Tokyo, Japan) with an oil immersion objective (100×). The serum samples obtained from normal mice were used as negative controls.

Comparative analysis of ELISA assays using single or combined rPfAMA-1 and rPfMSP-119

In the present study, IgG antibody responses of individuals during acute infection to rPfAMA-1 and rPfMSP-119 antigens (as single or in combination) were measured by an ELISA as described previously with some modifications [11]. In brief, Maxisorp flat-bottomed 96-well microplates (Grainer, Labortechnic, Germany) were coated duplicate with 200 ng of either rPfAMA-1 or rPfMSP-119 and in combination of rPfAMA-1and rPfMSP-119 (100 ng and/or 200 ng of each antigen/well) or GST alone (as control) in 0.06 M carbonate-bicarbonate buffer (pH 9.6) and then incubated at 4°C overnight. The plates were washed with PBS-Tween (PBS-T) and blocked with bovine serum albumin (BSA)-PBS-0.05% Tween. Serum was added in duplicate at a dilution of 1:200 (in BSA-PBS-0.05% Tween, 100 μl/well). After washing with PBS-T, the plates were incubated with horseradish peroxidase-conjugated goat anti-human IgG (Sigma, USA) at 1:35,000 concentration. Finally, the enzyme reaction was developed with o-phenylediamine dihydrochloride-H2O2 (OPD, Sigma, USA) and stopped with 2 N H2SO4. The OD was measured using an ELISA microplate reader (Biotech, USA) at 490 nm. All samples were re-tested if there was a discrepancy of greater than 20% between the duplicates. Standardization of the plates was achieved using positive-control serum pools on each plate. Background (determined from the wells with either no serum or GST) was subtracted from the mean of each sample, and a cut-off value was determined as the mean plus three standard deviations from the 30 negative control serum samples which were included in each assay.

Statistical analysis

A database was generated with SPSS 20.0 for windows (SPSS Inc., USA). As the antibody levels were not normally distributed, non-parametric tests were used. Differences in the proportions of IgG-positive subjects were assessed using the McNemar's test or Chi square comparison of proportions as appropriate. Furthermore, differences between the mean absorbance of antigens alone or in combination were analysed by using Wilcoxon Signed Ranks test or Friedman test as appropriate. The Spearman’s correlation test was also used to assess the association between antibody levels with age as well as exposure. P values < 0.05 were considered statistically significant. The sensitivity of each test was measured by dividing the number of positive IgG sera to total numbers of sera obtained from P. falciparum-infected individuals.

Results

Detection of P. falciparum parasites by nested PCR

Based on both microscopy and nested-PCR results, all 101 patients were shown to be infected with P. falciparum, as a mono-infection, and none of the healthy control individuals had either P. falciparum or P. vivax infection.

Recognition of native PfAMA-1 and PfMSP-119 on the surface of P. falciparum merozoite by mice polyclonal antibodies to rPAMA-1 and rPfMSP-119

Anti-rPfAMA-1 and -rPfMSP-119 produced in mice recognized the native protein present on the surface of P. falciparum merozoite at late schizont (or merozoite) stage with high intensity, as indicated by the grape-like fluorescence pattern (Figure 1A and B). Moreover, none of the control mice sera recognized the native protein on P. falciparum parasite (Figure 1C, D, E, and F), confirming that there are common epitopes in recombinant forms that correspond to native proteins. The reduced and non-reduced SDS-PAGE as well as Western blot analysis also confirmed that rPfAMA-1 (~55 kDa) and rPfMSP-119 (37.5 kDa) proteins had proper conformation and folding.
Figure 1

IFAT for recognition of native form of AMA-1 and MSP-1 19 on the P. falciparum parasites with polyclonal antibodies induced in mice. Green fluorescence is visible due to the recognition of surface AMA-1 and MSP-119 on P. falciparum merozoite by sera of the mice immunized with (A) rPfAMA-1+ CFA/IFA (n = 7); (B) rPfMSP-119 + CFA/ICFA (n = 7); (C) GST + CFA/ICFA (n = 7); (D) PBS + CFA/ICFA (n = 7); (E) PBS (n = 7); (F) normal mouse sera (n = 7). CFA: Complete Freund's adjuvant; IFA: Incomplete Freund's adjuvant.

Antibody responses to rPfAMA-1 antigen

PfAMA-1 was expressed in E. coli M15-pQE30, and the purified protein was analysed by SDS-PAGE with a molecular mass of ~55 kDa. The purity of the recombinant proteins was evaluated by Western blot assay. The result showed that expressed proteins migrated at different sizes in the presence and absence of 2ME contained a disulfide bound. Total IgG antibody responses to PfAMA-1 was determined in 101 individuals (aged 4 to 75 years; median = 27 years; Table 2) and only 87.1% (88/101) had positive IgG antibody responses to rPfAMA-1 antigen (Figure 2). None of the sera from healthy individuals (control group) contained IgG antibody to rPfAMA-1, which confirms the specificity of the present results.
Table 2

Comparative analysis of the level of IgG and subclass antibodies to rPfAMA-1 and rPfMSP-1 19 antigens among individuals with patent P. falciparum infection from south-eastern Iran

Antigen

Mean OD 490 ± SD

IgG

IgG1

IgG2

IgG3

IgG4

PfAMA-1

1.096 ± 0.393

1.307 ± 1.001

0.232 ± 0.027

0.938 ± 0.436

0.502 ± 0.144

Frequency of responders (%)

88 (87.1)

88 (87.1)

9 (8.9)

36 (35.6)

4 (4)

Cut-off

0.284

0.273

0.2

0.37

0.25

PfMSP-1 19

1.467 ± 0.619

1.654 ± 0.802

0.404 ± 0.191

0.936 ± 0.430

0.467 ± 0.088

Frequency of responders (%)

85 (84.2)

84(83.2)

10 (9.9)

44 (43.6)

4 (4)

Cut-off

0.323

0.319

0.215

0.357

0.2

P value (Spearman’s correlation test)

<0.0001

< 0.0001

< 0.0001

< 0.0001

< 0.0001

The mean OD490 nm value was considered as a measure of the anti-PfAMA-1 or -PfMSP-119 -specific antibody responses of each serum sample by ELISA assay. The cut-off values were calculated by mean ODs of normal human sera (n = 30) out of malaria- endemic areas plus 3 standard deviation (SD). There was a significant correlation among the mean ODs of IgG, IgG1, IgG2, IgG3, and IgG4 to PfAMA-1 and PfMSP-119 antigens (IgG, r = 0.603, P <0.0001, IgG1, r = 0.593, P < 0.0001; IgG2, r = 0.433, P < 0.0001; IgG3, r = 0.457, P < 0.0001; and IgG4, r = 0.464, P < 0.0001; Spearman’s correlation test).

Figure 2

Prevalence of IgG and its subclass responses to rPfAMA-1 and rPfMSP-1 19 antigens among individuals with P. falciparum patent infection (n = 101) from malaria-endemic area of Iran. No significant difference was observed in the proportions of IgG, IgG1, IgG2, IgG3, and IgG4 responses to PfAMA-1 and PfMSP-119 antigens (P > 0.05; McNemar's test). The cut-off values of the controls were as follow: IgG: 0.284, IgG1: 0.273, IgG2: 0.2, IgG3: 0.37, and IgG4: 0.25 for PfAMA-1 antigen; IgG: 0.323, IgG1: 0.319, IgG2: 0.215, IgG3: 0.357, and IgG4: 0.2 for PfMSP-119 antigen.

IgG subclass response to rPfAMA-1 antigen

Serum samples positive for total anti-rPfAMA-1 IgG were evaluated for IgG subclass responses to rPfAMA-1 antigen. In individuals who were infected with P. falciparum, the IgG1 to rPfAMA-1 (87.1%, OD490 = 1.307, Figure 2 and Table 2) was the dominant subclass. The second frequent subclass was IgG3 (35.6%, OD490 = 0.938, Figure 2 and Table 2). In case of IgG2 and IgG4, the frequency distribution of individuals that recognized the antigen was 8.9% and 4% (mean OD490 = 0.232 and 0.502, respectively; Figure 2 and Table 2). Furthermore, heterogeneity in IgG1 and IgG3 isotype responses was observed (Table 3). The results indicated that IgG1 and IgG3 were predominant over IgG2 and IgG4 antibodies. In addition, there were significant differences among the levels of IgG, IgG1, IgG2, and IgG4 antibodies (Friedman test, P < 0.05).
Table 3

The heterogeneity in IgG1 and IgG3 responses to rPfAMA-1 and rPfMSP-1 19 antigens in individuals with patent P. falciparum infection, living in Chabahar district of Iran

Antigen

IgG1 + /IgG3 + no. (%)

IgG1 + /IgG3 no. (%)

IgG1 /IgG3 + no. (%)

IgG1 /IgG3 no. (%)

χ 2 test P value

PfAMA-1

36 (35.6)

52 (51.5)

0

13 (12.9)

= 0.357

PfMSP-119

43 (42.6)

41(40.6)

1 (0.99)

16 (15.8)

Antibody responses to rPfMSP-119 antigen

PfMSP-119 was expressed in E. coli BL21-pGEX-KG, and the purified protein was analysed by SDS-PAGE with a molecular mass of ~37.5 kDa. The purity of the recombinant protein was evaluated by Western blot assay. The result showed that the expressed PfMSP-119 migrated as a single homogeneous band on SDS-PAGE under non-reducing conditions, indicating that it is largely composed of a single conformer. Total IgG antibody responses to rPfMSP-119 was determined in 101 individuals (aged 4 to 75 years; median = 27 years; Table 1) and only 84.2% (85/101) had positive IgG antibody responses to rPfMSP-119 antigen (Figure 2). None of the sera from healthy individuals (control group) contained IgG antibodies to PfMSP-119, which confirms the specificity of the present results.

IgG subclass response to rPfMSP-119 antigen

Serum samples positive for total anti-PfMSP-119 IgG were evaluated for IgG subclass responses to rPfMSP-119 antigen. In individuals who were infected with P. falciparum, the IgG1 to rPfMSP-119 (83.2%, OD490 = 1.654, Figure 2 and Table 2) was the dominant subclass. The second frequent subclass was IgG3 (43.6%, OD490 = 0.936, Figure 2 and Table 2). In case of IgG2 and IgG4, the frequency distribution of individuals that recognized the antigen was 9.9% and 4% (mean OD490 = 0.404 and 0.467, respectively; Figure 2 and Table 2). Furthermore, heterogeneity in IgG1 and IgG3 isotype responses of individuals was observed (Table 3). The results indicated that IgG1 and IgG3 were predominant over IgG2 and IgG4 antibodies. In addition, there were significant differences among the levels of IgG, IgG1, IgG2, IgG3, and IgG4 antibodies (Friedman test, P < 0.05).

Exposure- and age-dependent IgG, IgG1, and IgG3 responses

The levels of IgG, IgG1, and IgG3 antibodies to rPfAMA-1 were not correlated with exposure (r = 0.061, P = 0.544 for IgG; r = 0.042, P = 0.673 for IgG1, and r = 0.014, P = 0.893 for IgG3; Spearman’s correlation test) or age (r = 0.082, P = 0.416 for IgG; r = 0.060, P = 0.550 for IgG1, and r = 0.172, P = 0.085 for IgG3; Spearman’s correlation test). Likewise, the levels of IgG, IgG1, and IgG3 antibodies to the rPfMSP-119 were not correlated with exposure (r = 0.104, P = 0.302 for IgG; r = 0.013, P = 0.895 for IgG1, and r = −0.022, P = 0.826 for IgG3; Spearman’s correlation test) or age (r = 0.128, P = 0.2 for IgG; r = 0.078, P = 0.435 for IgG1, and r = 0.118, P = 0.242 for IgG3; Spearman’s correlation test).

Regarding the analysis of the correlation between the frequency of IgG antibodies and age, the sera of the 101 individuals were separated into three groups: (i) 1–15 years old (n = 8), 16–30 years old (n = 53), and ≥ 31 years old (n = 40). No significant difference was found in the prevalence of positive sera for PfAMA-1 and PfMSP-119-specific IgG, IgG1 and IgG3 antibodies in different age groups (Chi-square, P > 0.05, Figure 3A and B), indicating that antibody responses against PfAMA-1 and PfMSP-119 were not correlated with age. It was then determined whether there was a correlation between the frequency of IgG antibodies and episodes of P. falciparum infection. For this purpose, the sera of the 101 individuals were separated into two groups: (i) primary infected, individuals with no previous malaria episodes (n = 49) and (ii) individuals with one or more previous malaria episodes (n = 52). The frequency of responders to both antigens did not change significantly when they divided in primary and multiple-infected (Chi-Square test, P > 0.05) confirming that antibody response against PfAMA-1 and PfMSP-119 was established after a single exposure to malaria (Figure 4A and B). This result shows that specific IgG responses to both antigens are developed after even one malaria episode.
Figure 3

Association between age and IgG, IgG1, and IgG3 antibody responses to rPfAMA-1 (A) and rPfMSP-1 19 (B) antigens. The prevalence of positive responders for IgG, IgG1, and IgG3 antibodies for each age group is shown in the Figure. In the different age groups, no significant difference was observed in the prevalence of responders to PfAMA-1 and PfMSP-119 antigens for IgG, IgG1, and IgG3 (P > 0.05, X 2 test). Age groups are: 1–15 years (n = 8), 16–30 years (n =53), and ≥ 31 years (n = 40).

Figure 4

Association between episodes of P. falciparum infection and IgG, IgG1, and IgG3 antibody responses to PfAMA-1 (A) and PfMSP-1 19 (B) antigens. In the individuals with different malaria episodes (P > 0.05, X 2 test), no significant difference was observed in the prevalence of responders to PfAMA-1 and PfMSP-119 antigens for IgG, IgG1, and IgG3. The groups are: (i) no previous malaria episodes (n = 49) and (ii) individuals with one or more previous malaria episodes (n = 52).

Comparative analysis of the naturally acquired antibody responses to rPfAMA-1 and rPfMSP-119 antigens

The frequency of individuals with IgG antibodies to combined antigens (100 ng of each antigen/well) was only 86.2% during patent infection with P. falciparum. No response to either antigen was observed in 13.8% of the individuals (Figures 5 and 6; Table 4). The difference in the prevalence of anti-PfAMA-1 and -PfMSP-119 IgG responses in the tested samples was not statistically significant (with mean OD490 = 1.096 ± 0.393 and 1.467 ± 0.619; cut-offs 0.284 and 0.323, respectively; P = 0.25, McNemar's test; Table 4). None of the sera from control groups contained anti-PfAMA-1 and/or -PfMSP-119 IgG antibodies. The present data confirmed that the two antigens were immunogenic during natural infections. However, when rPfAMA-1 and rPfMSP-119 were combined at equal ratios of 200 ng (100 ng each antigen/well) and 400 (200 ng each antigen/well), sero-positivity of 86.2% and 87.1% were obtained, respectively (Figure 6, Table 4). Interestingly, 3% (3/101) of the tested samples had positive IgG antibody responses to rPfAMA-1 but not to rPfMSP-119 antigens, indicating the higher sensitivity of rPfAMA-1 than rPfMSP-119 (Figures 5 and 6, Table 4). There was also statistically difference among the mean absorbance of antibodies to both antigens when used in ELISA either alone or in combination (P < 0.05, Friedman test). However, when the mean absorbance was compared in paired groups, no significant difference was observed in the mean absorbance of antibodies to combination of rPfAMA-1 and rPfMSP-119 at concentration of either 200 ng or 400 ng (P > 0.05, Wilcoxon Signed Ranks test).
Figure 5

Pattern of total IgG responses to single rPfAMA-1, rPfMSP-1 19 , and combined antigens in individuals infected with P. falciparum (n = 101). Ages are given in years. Cut-off values were 0.284, 0.323, 0.351, and 0.36 for PfAMA-1, PfMSP-119, combined antigens with 100 ng of each and 200 ng of each, respectively. The OD mean values have been divided into the following groups: OD > 1.5: High-positive antibody responses (black). 1 < OD < 1.5: Medium-positive responses (dark gray), OD < 1: Low-positive responses (pale gray), and OD < Cut-off: Negative (white).

Figure 6

Prevalence of tested samples with positive IgG antibody responses to either rPfAMA-1 and rPfMSP-1 19 antigens alone or in combination (200 and 400 ng of antigens in equal ratio).

Table 4

Prevalence of IgG responses to rPfAMA-1, and rPfMSP-1 19 alone and in combination antigens in 101 samples of patients who were infected with P. falciparum

Antigen

Negative sera No. (%)

Positive sera No. (%)

Mean OD ± SD of positive samples

Cut-off value

PfAMA-1

13 (12.9%)

88 (87.1%)

1.096 ± 0.393

0.284

PfMSP-119

16 (15.8%)

85 (84.2%)

1.467 ± 0.619

0.323

Combined antigens (200 ng/well)

14 (13.8%)

87 (86.1%)

1.133 ± 0.379

0.351

Combine antigens (400 ng/well)

13 (12.9%)

88 (87.1%)

1.390 ± 0.437

0.351

Discussion

In elimination programmes, reduction in disease and death due to P. falciparum is the primary objective. Although the prospects of achieving global malaria eradication have been diminished by the limited available intervention tools, vaccines could be considered effectively in these programmes; for instance, they have also vital role in global eradication of smallpox and the elimination of Poliomyelitis from the world. Moreover, for vaccine development, sero-epidemiology studies on various populations with a different genetic background and endemicity in malaria settings would help to understand the host immune responses to malaria parasites as well as the endemicity of the disease. Besides, in malaria elimination programmes, monitoring changes in transmission intensity and identification of residual foci of malaria by using sensitive and reliable tools is very important for measuring the success of the programme. Therefore, the goal of this study was to compare and analyse the naturally acquired antibody responses to two recombinant proteins representing two asexual erythrocytic stage of P. falciparum (PfAMA-1 and PfMSP-119) by human IgG antibodies among naturally exposed individuals living in the malaria hypoendemic setting, Iran. These two proteins not only are the asexual erythrocytic stage vaccine candidates but also are serological markers particularly useful for detection of relative antibody responses in areas of low endemicity [53,58].

In the present investigation, both antigens were produced in E. coli, and the results showed that both expressed proteins were folded correctly and suitable for ELISA. The value of using recombinant protein in vaccine development against malaria has been also shown in earlier studies. These surveys demonstrated that the cysteine-rich sequence of PfMSP-119 with two epidermal growth factor (EGF)-like motifs [59] could be expressed in E. coli in a correctly folded manner [46], and that it plays an important role in the induction of protective immunity [60]. In addition, the protection elicited by AMA-1 is directed at epitopes dependent on the disulfide bonding [61] located in the AMA-1 ectodomain; hence, the correct conformation is critical for AMA-1 based vaccine development.

In elimination and eradication strategies, understanding the immunity to malaria parasites is crucial for successful and reliable interventions. The Iranian government aims to eliminate this poverty-related disease from malaria-endemic settings, mostly close to Pakistan and Afghanistan border areas, where both P. vivax (>80%) and P. falciparum (<20%) are prevalent. In the present work, the interaction between the host immune system and parasites showed that 87.1% and 84.2% of the studied individuals had positive anti-PfAMA-1 and -PfMSP-119 IgG antibody responses, respectively, suggesting that both of these expressed antigens are well-recognized asexual-stage parasite antigens. Although the present finding documents that the frequencies of antibodies to both recombinant antigens are almost similar in the areas of unstable transmission, the role of these antibodies in protection to malaria needs further study. However, the absence of such response in about 13% of the individuals could be perhaps explained by unknown human genetic factors [62] and/or the first or short exposure to these antigens, which may be insufficient to induce considerable immune responses. This slow development of naturally acquired malaria immunity has been shown by others in low to moderate malaria transmission settings [63,64].

Analysis of IgG isotype response to the PfAMA-1 and PfMSP-119 antigens is important for evaluating protective activity as IgG subclasses differ in their immune effector functions and having such knowledge is important for understanding the immunity to vaccine development. The result of the present study confirmed previous studies [42,54,65,66] that showed IgG1 and IgG3 isotypes were the predominant subclasses in response to both antigens. These subclass responses might perhaps relate to antigen properties, number of exposure, host age, and genetic determinants. The high prevalence of anti-PfMSP-119 IgG1 responses among studied individuals was in contrast to what was reported from Senegalese adults (in Dielmo and Ndiop) that a greater proportion of individuals were anti-MSP-1 IgG3 positive [67]. This finding was in line with earlier report of very little or no IgG3 to PfAMA-1 [66].

In addition, the present result was in contrast to the previous report that stated the frequency of PfMSP-119-specific IgG1 was higher among subjects (living in different areas of Brazil) with a long-term exposure to malaria, as compared to the subjects sporadically-exposed [68]. In this study, although anti-PfAMA-1 and -PfMSP-119 IgG1 was predominant, there was also a mixed IgG1/IgG3 response as reported by others [69]. This heterogeneity in IgG1 and IgG3 recognition could be related to either different epitopes in PfAMA-1 antigen recognized by these two IgG subclasses or short half-life of IgG3 antibody in the serum sample. Moreover, it is well established that IgG1 and IgG3 subclasses mediate opsonization and complement fixation of pathogens, and they are involved in antibody-mediated protective immunity against Plasmodium blood stages [70,71]. Therefore, the finding that IgG subclasses to both antigens are mainly of the IgG1/IgG3 type with high frequencies indicate that this high prevalence might be associated with protective effect on cell-mediated mechanisms from falciparum malaria as shown by others [15,42,65-75].

As the interaction between the host immune system and parasites differs based on the degree of the malaria endemicity, it has been suggested that in malaria high-endemic areas, the acquisition of natural immunity to P. falciparum requires several years of uninterrupted exposure [68,76]. However, in hypoendemic or mesoendemic areas, there is no association between age and exposure to malaria [7-9]. In the present study, in the unstable and low malaria transmission, the frequency of responders to PfAMA-1 and PfMSP-119 was not correlated with either age or number of exposure to malaria, which confirms the previous reports [7-9] and indicates that PfAMA-1 and PfMSP-119 are highly immunogenic during natural human infections. The present result was also in agreement with the result of previous studies in low-endemic areas of Senegal [32] and West Africa [41,77], where no such correlation was observed. Nevertheless, a statistically significant age-related change in antibody levels to PfAMA-1 [78] and PfMSP-119 [79] was observed in the previous studies.

In the advanced phases of malaria elimination programmes, the technique for assessment of malaria transmission intensity and evaluation of interventions during this effort are highly required. Recently, there has been a recall for elimination of malaria with the scaling-up interventions; therefore, malaria burden and transmission declined across a number of countries [80-82]. In such situations, serological techniques using reliable markers could be applied for detecting and targeting clusters of infection, to reduce the local parasite reservoir and interrupt transmission [83]. In this study, the applicability of using two serological markers to detect sero-positive cases in such an unstable, hypoendemic, and low transmission settings, where the sensitivity of parasite prevalence surveys is limited, was tested. Each antigen was highly specific and reactive to the tested sera, and the sensitivity of a single antigen for detection was similar with that of the two combined antigens. Nevertheless, since 3% of samples were positive for PfAMA-1 but negative for PfMSP-119, the present study is in favour of using multiple antigens for antibody-based detection in this area and other similar settings during elimination programmes.

Conclusion

In summary, the present results suggest that the two tested recombinant antigens are immunogenic molecules and useful tools to perform immuno-epidemiological studies in low transmission areas of Iran. These data also provide, for the first time, information on the characteristics of naturally acquired immunity in populations exposed to malaria transmission in Iran. Indeed, it could be beneficial for development and testing of a PfAMA-1 and PfMSP-119-based vaccine in Iran, where malaria is endemic. This study specially demonstrates high level frequencies of antibodies to rPfAMA-1 and rPfMSP-119 among individuals infected with P. falciparum in areas of unstable and low transmission, indicating that these two expressed antigens could be used in combination as serology markers during elimination campaigns in this region.

Declarations

Acknowledgements

This study was partially supported by Institut Pasteur Iran to S. Zakeri. We are grateful for the hospitality and generous collaboration of Zahedan University of Medical Sciences, staff in Public Health Department, Sistan and Baluchistan Province and Chabahar District for their assistance in collection of human blood samples.

Authors’ Affiliations

(1)
Malaria and Vector Research Group (MVRG), Biotechnology Research Center (BRC), Pasteur Institute of Iran

References

  1. Snow RW, Guerra CA, Noor AM, Myint HY, Hay SI. The global distribution of clinical episodes of Plasmodium falciparum malaria. Nature. 2005;434:214–7.View ArticlePubMed CentralPubMedGoogle Scholar
  2. Miller LH, Baruch DI, Marsh K, Doumbo OK. The pathogenic basis of malaria. Nature. 2002;415:673–9.View ArticlePubMedGoogle Scholar
  3. malERA Consultative Group on Vaccines. A research agenda for malaria eradication: vaccines. PLoS Med. 2011;8:e1000398.View ArticleGoogle Scholar
  4. Kilama W, Ntoumi F. Malaria: a research agenda for the eradication era. Lancet. 2009;374:1480–2.View ArticlePubMedGoogle Scholar
  5. Volkman SK, Ndiaye D, Diakite M, Koita OA, Nwakanma D, Daniels RF, et al. Application of genomics to field investigations of malaria by the international centers of excellence for malaria research. Acta Trop. 2012;121:324–32.View ArticlePubMed CentralPubMedGoogle Scholar
  6. Courtin D, Oesterholt M, Huismans H, Kusi K, Milet J, Badaut C, et al. The quantity and quality of African children's IgG responses to merozoite surface antigens reflect protection against Plasmodium falciparum malaria. PLoS ONE. 2009;4:e7590.View ArticlePubMed CentralPubMedGoogle Scholar
  7. Camargo LM, Dal Colletto GM, Ferreira MU, GurgelSde M, Escobar AL, Marques A, et al. Hypoendemic malaria in Rondonia (Brazil, western Amazon region): seasonal variation and risk groups in an urban locality. Am J Trop Med Hyg. 1996;55:32–8.PubMedGoogle Scholar
  8. Camargo LM, Ferreira MU, Krieger H, De Camargo EP, Da Silva LP. Unstable hypoendemic malaria in Rondonia (western Amazon region, Brazil): epidemic outbreaks and work-associated incidence in an agro-industrial rural settlement. Am J Trop Med Hyg. 1994;51:16–25.PubMedGoogle Scholar
  9. Marsh K, Snow RW. Host-parasite interaction and morbidity in malaria endemic areas. Philos Trans R SocLond B BiolSci. 1997;352:1385–94.View ArticleGoogle Scholar
  10. Mehrizi AA, Zakeri S, Salmanian AH, Sanati MH, Djadid ND. IgG subclasses pattern and high-avidity antibody to the C-terminal region of merozoite surface protein 1 of Plasmodium vivax in an unstable hypoendemic region in Iran. Acta Trop. 2009;112:1–7.View ArticlePubMedGoogle Scholar
  11. Mehrizi AA, Asgharpour S, Salmanian AH, Djadid ND, Zakeri S. IgG subclass antibodies to three variants of Plasmodium falciparum merozoite surface protein-1 (PfMSP–1(19)) in an area with unstable malaria transmission in Iran. Acta Trop. 2011;119:84–90.View ArticlePubMedGoogle Scholar
  12. Wickramarachchi T, Illeperuma RJ, Perera L, Bandara S, Holm I, Longacre S, et al. Comparison of naturally acquired antibody responses against the C-terminal processing products of Plasmodium vivax Merozoite Surface Protein-1 under low transmission and unstable malaria conditions in Sri Lanka. Int J Parasitol. 2007;37:199–208.View ArticlePubMedGoogle Scholar
  13. Cohen S, Mcgregor IA, Carrington S. Gamma-globulin and acquired immunity to human malaria. Nature. 1961;192:733–7.View ArticlePubMedGoogle Scholar
  14. McGregor IA, Carrington SP, Cohen S. Treatment of East African P. falciparum malaria with West African human γ–globulin. Trans R Soc Trop Med Hyg. 1963;57:170–5.View ArticleGoogle Scholar
  15. Sabchareon A, Burnouf T, Ouattara D, Attanath P, Bouharoun-Tayoun H, Chantavanich P, et al. Parasitologic and clinical human response to immunoglobulin administration in falciparum malaria. Am J Trop Med Hyg. 1991;45:297–308.PubMedGoogle Scholar
  16. Brown GV, Anders RF, Mitchell GF, Heywood PF. Target antigens of purified human immunoglobulins which inhibit growth of Plasmodium falciparum in vitro. Nature. 1982;297:591–0593.View ArticlePubMedGoogle Scholar
  17. Miao J, Li X, Liu Z, Xue C, Bujard H, Cui L. Immune responses in mice induced by prime-boost schemes of the Plasmodium falciparum apical membrane antigen 1 (PfAMA1)-based DNA, protein and recombinant modified vaccinia Ankara vaccines. Vaccine. 2006;24:6187–98.View ArticlePubMedGoogle Scholar
  18. Saul A, Lawrence G, Allworth A, Elliott S, Anderson K, Rzepczyk C, et al. A human phase 1 vaccine clinical trial of the Plasmodium falciparum malaria vaccine candidate apical membrane antigen 1 in Montanide ISA720 adjuvant. Vaccine. 2005;23:3076–83.View ArticlePubMedGoogle Scholar
  19. Malkin EM, Diemert DJ, McArthur JH, Perreault JR, Miles AP, Giersing BK, et al. Phase 1 clinical trial of apical membrane antigen 1: an asexual blood-stage vaccine for Plasmodium falciparum malaria. Infect Immun. 2005;73:3677–85.View ArticlePubMed CentralPubMedGoogle Scholar
  20. Ellis RD, Sagara I, Doumbo O, Wu Y. Blood stage vaccines for Plasmodium falciparum: current status and the way forward. Hum Vaccin. 2010;6:627–34.View ArticlePubMed CentralPubMedGoogle Scholar
  21. Riley EM, Allen SJ, Wheeler JG, Blackman MJ, Bennett S, Takacs B, et al. Naturally acquired cellular and humoral immune responses to the major merozoite surface antigen (PfMSP1) of Plasmodium falciparum are associated with reduced malaria morbidity. Parasite Immunol. 1992;14:321–37.View ArticlePubMedGoogle Scholar
  22. Remarque EJ, Faber BW, Kocken CH, Thomas AW. Apical membrane antigen 1: a malaria vaccine candidate in review. Trends Parasitol. 2008;24:74–84.View ArticlePubMedGoogle Scholar
  23. Bannister LH, Hopkins JM, Dluzewski AR, Margos G, Williams IT, Blackman MJ, et al. Plasmodium falciparum apical membrane antigen 1 (PfAMA-1) is translocated within micronemes along subpellicular microtubules during merozoite development. J Cell Sci. 2003;116:3825–34.View ArticlePubMedGoogle Scholar
  24. Silvie O, Franetich JF, Charrin S, Mueller MS, Siau A, Bodescot M, et al. A role for apical membrane antigen 1 during invasion of hepatocytes by Plasmodium falciparum sporozoites. J Biol Chem. 2004;279:9490–6.View ArticlePubMedGoogle Scholar
  25. Healer J, Crawford S, Ralph S, McFadden G, Cowman AF. Independent translocation of two micronemal proteins in developing Plasmodium falciparum merozoites. Infect Immun. 2002;70:5751–8.View ArticlePubMed CentralPubMedGoogle Scholar
  26. Narum DL, Thomas AW. Differential localization of full-length and processed forms of PF83/AMA-1 an apical membrane antigen of Plasmodium falciparum merozoites. Mol Biochem Parasitol. 1994;67:59–68.View ArticlePubMedGoogle Scholar
  27. Howell SA, Well I, Fleck SL, Kettleborough C, Collins CR, Blackman MJ. A single malaria merozoite serine protease mediates shedding of multiple surface proteins by juxta membrane cleavage. J Biol Chem. 2003;278:23890–8.View ArticlePubMedGoogle Scholar
  28. Howell SA, Withers-Martinez C, Kocken CH, Thomas AW, Blackman MJ. Proteolytic processing and primary structure of Plasmodium falciparum apical membrane antigen-1. J Biol Chem. 2001;276:31311–20.View ArticlePubMedGoogle Scholar
  29. Hodder AN, Crewther PE, Matthew ML, Reid GE, Moritz RL, Simpson RJ, et al. The disulfide bond structure of Plasmodium apical membrane antigen-1. J Biol Chem. 1996;271:29446–52.View ArticlePubMedGoogle Scholar
  30. Johnson AH, Leke RG, Mendell NR, Shon D, Suh YJ, Bomba-Nkolo D, et al. Human leukocyte antigen class II allele sinfluence levels of antibodies to the Plasmodium falciparum asexual-stage apical membrane antigen 1 but not to merozoite surface antigen 2 and merozoite surface protein 1. Infect Immun. 2004;72:2762–71.View ArticlePubMed CentralPubMedGoogle Scholar
  31. Kennedy MC, Wang J, Zhang Y, Miles AP, Chitsaz F, Saul A, et al. In vitro studies with recombinant Plasmodium falciparum apical membrane antigen 1 (AMA1): production and activity of an AMA1 vaccine and generation of a multi allelic response. Infect Immun. 2002;70:6948–60.View ArticlePubMed CentralPubMedGoogle Scholar
  32. Thomas AW, Trape JF, Rogier C, Goncalves A, Rosario VE, Narum DL. High prevalence of natural antibodies against Plasmodium falciparum 83-kilo Dalton apical membrane antigen (PF83/AMA-1) as detected by capture-enzyme-linked immunosorbent assay using full-length baculo virus recombinant PF83/AMA–1. Am J Trop Med Hyg. 1994;51:730–40.PubMedGoogle Scholar
  33. Hodder AN, Crewther PE, Anders RF. Specificity of the protective antibody response to apical membrane antigen 1. Infect Immun. 2001;69:3286–94.View ArticlePubMed CentralPubMedGoogle Scholar
  34. Anders RF, Crewther PE, Edwards S, Margetts M, Matthew ML, Pollock B, et al. Immunisation with recombinant AMA-1 protects mice against infection with Plasmodium chabaudi. Vaccine. 1998;16:240–7.View ArticlePubMedGoogle Scholar
  35. Collins WE, Pye D, Crewther PE, Vandenberg KL, Galland GG, Sulzer AJ, et al. Protective immunity induced in squirrel monkeys with recombinant apical membrane antigen-1 of Plasmodium fragile. Am J Trop Med Hyg. 1994;51:711–9.PubMedGoogle Scholar
  36. Holder AA, Blackman MJ, Burghaus PA, Chappel JA, Ling IT, McCallum-Deighton N, et al. A malaria merozoite surface protein (MSP1)-structure, processing and function. Mem Inst Oswaldo Cruz. 1992;3:37–42.View ArticleGoogle Scholar
  37. O'Donnell RA, De Koning–Ward TF, Burt RA, Bockarie M, Reeder JC, Cowman AF, et al. Antibodies against merozoite surface protein (MSP)-1(19) are a major component of the invasion-inhibitory response in individuals immune to malaria. J Exp Med. 2001;193:1403–12.View ArticlePubMed CentralPubMedGoogle Scholar
  38. Good MF, Kaslow DC, Miller LH. Pathways and strategies for developing a malaria blood-stage vaccine. Annu Rev Immunol. 1998;16:57–87.View ArticlePubMedGoogle Scholar
  39. Cooper JA, Cooper LT, Saul AJ. Mapping of the region predominantly recognized by antibodies to the Plasmodium falciparum merozoite surface antigen MSA 1. Mol Biochem Parasitol. 1992;51:301–12.View ArticlePubMedGoogle Scholar
  40. Daly TM, Long CA. Humoral response to a carboxyl-terminal region of the merozoite surface protein-1 plays a predominant role in controlling blood-stage infection in rodent malaria. J Immunol. 1995;155:236–43.PubMedGoogle Scholar
  41. Blackman MJ, Heidrich HG, Donachie S, McBride JS, Holder AA. A single fragment of a malaria merozoite surface protein remains on the parasite during red cell invasion and is the target of invasion-inhibiting antibodies. J Exp Med. 1990;172:379–82.View ArticlePubMedGoogle Scholar
  42. Chang SP, Gibson HL, Lee–Ng CT, Barr PJ, Hui GS. A carboxyl-terminal fragment of Plasmodium falciparum gp195 expressed by a recombinant baculo virus induces antibodies that completely inhibit parasite growth. J Immunol. 1992;149:548–55.PubMedGoogle Scholar
  43. Chappel JA, Holder AA. Monoclonal antibodies that inhibit Plasmodium falciparum invasion in vitro recognise the first growth factor-like domain of merozoite surface protein-1. Mol Biochem Parasitol. 1993;60:303–11.View ArticlePubMedGoogle Scholar
  44. Egan AF, Morris J, Barnish G, Allen S, Greenwood BM, Kaslow DC, et al. Clinical immunity to Plasmodium falciparum malaria is associated with serum antibodies to the 19-kDa C-terminal fragment of the merozoite surface antigen, PfMSP-1. J Infect Dis. 1996;173:765–9.View ArticlePubMedGoogle Scholar
  45. Shi YP, Sayed U, Qari SH, Roberts JM, Udhayakumar V, Oloo AJ, et al. Natural-immune-response to the C-terminal19-kilo-dalton-domain of Plasmodium falciparum merozoite surface protein 1. Infect Immun. 1996;64:2716–23.PubMed CentralPubMedGoogle Scholar
  46. Al-Yaman F, Genton B, Kramer KJ, Chang SP, Hui GS, Baisor M, et al. Assessment of the role of naturally acquired antibody levels to Plasmodium falciparum merozoite surface protein-1 in protecting Papua New Guinean children from malaria morbidity. Am J Trop Med Hyg. 1996;54:443–8.PubMedGoogle Scholar
  47. Zakeri S, Mehrizi AA, Zoghi S, Djadid ND. Non-variant specific antibody responses to the C-terminal region of merozoite surface protein-1 of Plasmodium falciparum (PfMSP-1(19)) in Iranians exposed to unstable malaria transmission. Malar J. 2010;9:257.View ArticlePubMed CentralPubMedGoogle Scholar
  48. Zakeri S, Babaeekhou L, Mehrizi AA, Abbasi M, Djadid ND. Antibody responses and avidity of naturally acquired anti-Plasmodium vivax Duffy binding protein (PvDBP) antibodies in individuals from an area with unstable malaria transmission. Am J Trop Med Hyg. 2011;84:944–50.View ArticlePubMed CentralPubMedGoogle Scholar
  49. Valizadeh V, Zakeri S, Mehrizi AA, Djadid ND. Non-allele specific antibody responses to genetically distinct variant forms of Plasmodium vivax Duffy binding protein (PvDBP-II) in Iranians exposed to seasonal malaria transmission. Acta Trop. 2014;136:89–100.View ArticlePubMedGoogle Scholar
  50. Polley SD, Tetteh KK, Cavanagh DR, Pearce RJ, Lloyd JM, Bojang KA, et al. Repeat sequences in block2 of Plasmodium falciparum merozoite surface protein 1 are targets of antibodies associated with protection from malaria. Infect Immun. 2003;71:1833–42.View ArticlePubMed CentralPubMedGoogle Scholar
  51. Polley SD, Mwangi T, Kocken CH, Thomas AW, Dutta S, Lanar DE, et al. Human antibodies to recombinant protein constructs of Plasmodium falciparum Apical Membrane Antigen1 (AMA1) and their associations with protection from malaria. Vaccine. 2004;23:718–28.View ArticlePubMedGoogle Scholar
  52. Corran P, Coleman P, Riley E, Drakeley C. Serology: a robust indicator of malaria transmission intensity? Trends Parasitol. 2007;23:575–82.View ArticlePubMedGoogle Scholar
  53. Drakeley CJ, Corran PH, Coleman PG, Tongren JE, McDonald SL, Carneiro I, et al. Estimating medium- and long-term trends in malaria transmission by using serological markers of malaria exposure. Proc Natl Acad Sci U S A. 2005;102:5108–13.View ArticlePubMed CentralPubMedGoogle Scholar
  54. Voller A, Cornille-Brögger R, Storey J, Molineaux L. A longitudinal study of Plasmodium falciparum malaria in the West African savannah using the ELISA technique. Bull World Health Organ. 1980;58:429–38.PubMed CentralPubMedGoogle Scholar
  55. Cornille-Brögger R, Mathews HM, Storey J, Ashkar TS, Brögger S, Molineaux L. Changing patterns in the humoral immune response to malaria before, during, and after the application of control measures: a longitudinal study in the West African savanna. Bull World Health Organ. 1978;56:579–600.PubMedGoogle Scholar
  56. Snounou G, Viriyakosol S, Zhu XP, Jarra W, Pinheiro L, Do Rosario VE, et al. High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol Biochem Parasitol. 1993;61:315–20.View ArticlePubMedGoogle Scholar
  57. Mehrizi AA, Sepehri M, Karimi F, Djadid ND, Zakeri S. Population genetics, sequence diversity and selection in the gene encoding the Plasmodium falciparum apical membrane antigen 1 in clinical isolates from the south-east of Iran. Infect Genet Evol. 2013;17:51–61.View ArticlePubMedGoogle Scholar
  58. Bousema T, Youssef RM, Cook J, Cox J, Alegana VA, Amran J, et al. Serologic markers for detecting malaria in areas of low endemicity, Somalia, 2008. Emerg Infect Dis. 2010;16:392–9.View ArticlePubMed CentralPubMedGoogle Scholar
  59. Blackman MJ, Ling IT, Nicholls SC, Holder AA. Proteolytic processing of the Plasmodium falciparum merozoite surface protein-1 produces a membrane-bound fragment containing two epidermal growth factor–like domains. Mol Biochem Parasitol. 1991;49:29–33.View ArticlePubMedGoogle Scholar
  60. Ling IT, Ogun SA, Holder AA. Immunization against malaria with a recombinant protein. Parasite Immunol. 1994;16:63–7.View ArticlePubMedGoogle Scholar
  61. Aribot G, Rogier C, Sarthou JL, Trape JF, Balde AT, Druilhe P, et al. Pattern of immunoglobulin isotype response to Plasmodium falciparum blood-stage antigens in individuals living in a holoendemic area of Senegal (Dielmo, West Africa). Am J Trop Med Hyg. 1996;54:449–57.PubMedGoogle Scholar
  62. Modiano D, Petrarca V, Sirima BS, Nebié I, Diallo D, Esposito F, et al. Different response to Plasmodium falciparum malaria in West African sympatric ethnic groups. Proc Natl Acad Sci U S A. 1996;93:13206–11.View ArticlePubMed CentralPubMedGoogle Scholar
  63. Snow RW, Marsh K. New insights into the epidemiology of malaria relevant for disease control. Br Med Bull. 1998;54:293–309.View ArticlePubMedGoogle Scholar
  64. Wipasa J, Suphavilai C, Okell LC, Cook J, Corran PH, Thaikla K, et al. Long-lived antibody and B-Cell memory responses to the human malaria parasites: plasmodium falciparum and Plasmodium vivax. PLoS Pathog. 2010;6:e1000770.View ArticlePubMed CentralPubMedGoogle Scholar
  65. Nebie I, Diarra A, Ouedraogo A, Soulama I, Bougouma EC, Tiono AB, et al. Humoral responses to Plasmodium falciparum blood-stage antigens and association with incidence of clinical malaria in children living in an area of seasonal malaria transmission in Burkina Faso, West Africa. Infect Immun. 2008;76:759–66.View ArticlePubMed CentralPubMedGoogle Scholar
  66. Tongren JE, Drakeley CJ, McDonald SL, Reyburn HG, Manjurano A, Nkya WM, et al. Target antigen, age, and duration of antigen exposure independently regulate immunoglobulin G subclass switching in malaria. Infect Immun. 2006;74:257–64.View ArticlePubMed CentralPubMedGoogle Scholar
  67. Nguer CM, Diallo TO, Diouf A, Tall A, Dieye A, Perraut R, et al. Plasmodium falciparum- and merozoite surface protein 1-specific antibody isotype balance in immune Senegalese adults. Infect Immun. 1997;65:4873–6.PubMed CentralPubMedGoogle Scholar
  68. Braga EM, Barros RM, Reis TA, Fontes CJ, Morais CG, Martins MS, et al. Association of the IgG response to Plasmodium falciparum merozoite protein (C–terminal 19kD) with clinical immunity to malaria in the Brazilian Amazon region. Am J Trop Med Hyg. 2002;66:461–6.PubMedGoogle Scholar
  69. Stanisic DI, Richards JS, McCallum FJ, Michon P, King CL, Schoepflin S, et al. Immunoglobulin G subclass-specific responses against Plasmodium falciparum merozoite antigens are associated with control of parasitemia and protection from symptomatic illness. Infect Immun. 2009;77:1165–74.View ArticlePubMed CentralPubMedGoogle Scholar
  70. Feng ZP, Keizer DW, Stevenson RA, Yao S, Babon JJ, Murphy VJ, et al. Structure and inter-domain interactions of domain II from the blood-stage malarial protein, apical membrane antigen 1. J Mol Biol. 2005;350:641–56.View ArticlePubMedGoogle Scholar
  71. Collins CR, Withers-Martinez C, Bentley GA, Batchelor AH, Thomas AW, Blackman MJ. Fine mapping of an epitope recognized by an invasion-inhibitory mono clonal antibody on the malaria vaccine candidate apical membrane antigen 1. J Biol Chem. 2007;282:7431–41.View ArticlePubMedGoogle Scholar
  72. Egan AF, Chappel JA, Burghaus PA, Morris JS, McBride JS, Holder AA, et al. Serum antibodies from malaria-exposed people recognize conserved epitopes formed by the two epidermal growth factor motifs of MSP1(19), the carboxy-terminal fragment of the major merozoite surface protein of Plasmodium falciparum. Infect Immun. 1995;63:456–66.PubMed CentralPubMedGoogle Scholar
  73. Cavanagh DR, Dobaño C, Elhassan IM, Marsh K, Elhassan A, Hviid L, et al. Differential patterns of human immunoglobulin G subclass responses to distinct regions of a single protein, the merozoite surface protein1 of Plasmodium falciparum. Infect Immun. 2001;69:1207–11.View ArticlePubMed CentralPubMedGoogle Scholar
  74. Bouharoun-Tayoun H, Druilhe P. Plasmodium falciparum malaria: evidence for an isotype imbalance which may be responsible for delayed acquisition of protective immunity. Infect Immun. 1992;60:1473–81.PubMed CentralPubMedGoogle Scholar
  75. Groux H, Gysin J. Opsonization as an effector mechanism in human protection against asexual blood stages of Plasmodium falciparum: functional role of IgG subclasses. Res Immunol. 1990;141:529–42.View ArticlePubMedGoogle Scholar
  76. Theander TG. Defence mechanisms and immune evasion in the interplay between the humane immune system and Plasmodium falciparum. Dan Med Bull. 1992;39:49–63.PubMedGoogle Scholar
  77. Dodoo D, Theander TG, Kurtzhals JA, Koram K, Riley E, Akanmori BD, et al. Levels of antibody to conserved parts of Plasmodium falciparum merozoite surface protein 1 in Ghanaian children are not associated with protection from clinical malaria. Infect Immun. 1999;67:2131–7.PubMed CentralPubMedGoogle Scholar
  78. Supargiyono S, Bretscher MT, Wijayanti MA, Sutanto I, Nugraheni D, Rozqie R, et al. Seasonal changes in the antibody responses against Plasmodium falciparum merozoite surface antigens in areas of differing malaria endemicity in Indonesia. Malar J. 2013;12:444.View ArticlePubMed CentralPubMedGoogle Scholar
  79. Baird JK. Age-dependent characteristics of protection vs. susceptibility to Plasmodium falciparum. Ann Trop Med Parasitol. 1998;92:367–90.View ArticlePubMedGoogle Scholar
  80. Gething PW, Smith DL, Patil AP, Tatem AJ, Snow RW, Hay SI. Climate change and the global malaria recession. Nature. 2010;465:342–5.View ArticlePubMed CentralPubMedGoogle Scholar
  81. Murray CJ, Rosenfeld LC, Lim SS, Andrews KG, Foreman KJ, Haring D, et al. Global malaria mortality between 1980 and 2010: a systematic analysis. Lancet. 2012;379:413–31.View ArticlePubMedGoogle Scholar
  82. Cotter C, Sturrock HJ, Hsiang MS, Liu J, Phillips AA, Hwang J, et al. The changing epidemiology of malaria elimination: new strategies for new challenges. Lancet. 2013;382:900–11.View ArticlePubMedGoogle Scholar
  83. WHO. Disease surveillance for malaria elimination: an operational manual. Geneva: World Health Organization; 2012. Available: http://www.who.int/malaria/publications/atoz/9789241503334/en/index.html. Accessed Feb 2013.Google Scholar

Copyright

© Rouhani et al.; licensee BioMed Central. 2015

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Advertisement