Skip to content


  • Methodology
  • Open Access

Easy and fast method for expression and native extraction of Plasmodium vivax Duffy binding protein fragments

  • 1, 2,
  • 1,
  • 3,
  • 1,
  • 4 and
  • 1, 5Email author
Malaria Journal201817:76

  • Received: 22 November 2017
  • Accepted: 30 January 2018
  • Published:



The Plasmodium vivax Duffy binding protein (PvDBP) has been the most studied ligand binding human reticulocytes to date. This molecule has a cysteine-rich domain in region II (RII) which has been used as control for evaluating the target cell binding activity of several parasite molecules. However, obtaining rPvDBP-RII in a soluble form using the Escherichia coli expression system usually requires laborious and time-consuming steps for recovering the molecule’s structure and function, considering it is extracted from inclusion bodies. The present study describes an easy and fast method for expressing and obtaining several PvDBP fragments which should prove ideal for use in protein–cell interaction assays.


Two PvDBP encoding regions (rii and riii/v) were cloned in pEXP5-CT vector and expressed in E. coli and extracted from the soluble fraction (rPvDBP-RIIS and rPvDBP-RIII/VS) using a simple freezing/thawing protocol. After the purification, dichroism analysis enabled verifying high rPvDBP-RIIS and rPvDBP-RIII/VS secondary structure α-helix content, which was lowered when molecules were extracted from inclusion bodies (rPvDBP-RIIIB and rPvDBP-RIII/VIB) using a denaturing step. Interestingly, rPvDBP-RIIS, but not rPvDBP-RIIIB, bound to human reticulocytes, while rPvDBP-RIII/VS and rPvDBP-RIII/VIB bound to such cells in a similar way to negative control (cells incubated without recombinant proteins).


This research has shown for the first time how rPvDBP-RII can be expressed and obtained in soluble form using the E. coli system and avoiding the denaturation and refolding steps commonly used. The results highlight the usefulness of the rPvDBP-RIII/VS fragment as a non-binding control for protein-cell target interaction assays. The soluble extraction protocol described is a good alternative to obtain fully functional P. vivax proteins in a fast and easy way, which will surely prove useful to laboratories working in studying this parasite’s biology.


  • Plasmodium vivax
  • Reticulocyte
  • Duffy binding protein
  • Soluble extraction
  • Protein–cell interaction


Plasmodium merozoite invasion of human erythrocytes is a complex process requiring the interaction of specific molecules, i.e. parasite ligands and cell receptors [1]. Only one route used by Plasmodium vivax for invading reticulocytes, in which the Duffy binding protein (PvDBP) participates, has been experimentally confirmed to date; such molecule is located in the parasite’s micronemes and interacts with the Duffy antigen receptor for chemokines (DARC) located on erythrocyte membrane [2, 3]. PvDBP belongs to a family of erythrocyte binding proteins. These have two conserved regions [domains rich in cysteine (Cys) amino acids] having a high level of homology between Plasmodium falciparum, P. vivax and Plasmodium knowlesi [4], which would suggest a common evolutionary origin and the conservation of erythrocyte binding domains in evolutionarily distant parasite species.

Eukaryote systems have been used to produce several PvDBP fragments in a native form and characterize their cell-binding activity. As an example, Chitnis et al. [5] built several vectors containing DNA sequences encoding for several PvDBP regions (RI, RII, RIII/V and RVI), which were transfected in COS-7 cells with a confluence of 30–50%. The cells were cultured in a humified CO2 (5%) incubator at 37 °C and then were used for erythrocyte binding assays. The results showed that Duffy positive human erythrocytes (Duffy+), but not those treated with chymotrypsin (which removes DARC), formed rosettes on COS-7 cell surface expressing PvDBP-RII recombinantly (r) (rPvDBP-RII); this enabled identifying this domain’s role in binding. In 1999, Ranjan et al. [6] used the rosette formation assay for mapping the region within the RII domain responsible for binding to human and primate erythrocytes. The authors expressed rPvDBP-RII in several fragments (including some Cys residues) on mammal COS cell surface and found that human erythrocytes were capable of forming rosettes only with cells expressing the fragment from Cys 4 to Cys 7 (PvDBP region II). On the other hand, Dutta et al. [7] produced rPvDBP-RII in Spodoptera frugiperda 21 (Sf21) insect cells’ culture supernatant using a bioreactor and maintaining the dissolved oxygen level at 60% of air saturation. The molecule so purified using a two-step purification protocol by FPLC was able to bind Duffy+ human erythrocytes and also induced a natural immune response blocking rPvDBP-RII interaction with cells.

An Escherichia coli prokaryotic expression system has also been used for obtaining recombinant proteins as it is extremely cheap, easy to use and molecules can be expressed in abundance and in a short time (maximum 1 day), compared to the eukaryote system (from 3 to 4 days). Fraser et al. [8] expressed the rPvDBP-RII/IV-GST fusion protein (which includes a hydrophilic Cys-free region contiguous to RII) in E. coli and extracted the molecule by sonication in phosphate buffer saline (PBS) (three times for 1.5–2 min each one) and purified it by the standard GST fusion method. Even rPvDBP-RII/IV was obtained in soluble form and was antigenic during natural infection, the molecule had no erythrocyte binding activity. Later, Dutta et al. [7] reported that rPvDBP-RII was predominantly found in the insoluble fraction (inclusion bodies (IB)) of E. coli culture. However, the extracted molecule was unable to bind to erythrocytes when using a denaturing step.

The only protocol for obtaining fully functional rPvDBP-RII from a prokaryotic system has been described by Singh et al. The authors used the E. coli system for expressing rPvDBP-RII and extracting it from IB using urea as denaturing agent. rPvDBP-RII was subjected to a refolding step in redox conditions (called rapid dilution method) for 36 h at 10 °C, dialyzed for 48 h against PBS and purified by ion exchange chromatography and gel filtration [9]. Two milligrams per liter of culture were produced with 98% of rPvDBP-RII protein purity. Biochemical and functional characterization corroborated that the molecule was immunogenic in rabbits and had suitable structural formation as rPvDBP-RII specifically bound to Duffy+ erythrocytes.

Bhardwaj et al. [10], recently used an exponential feeding strategy for optimizing rPvDBP-RII expression. The method was focused on using the pvdbp-rii synthetic gene with codon optimization for improving rPvDBP-RII production, also taking advantage of high cell density achieved by fed-batch fermentation where the pH, stirring speed, dissolved oxygen and air flow variables were controlled. More than 95% of the protein was extracted from IB, refolded by rapid dilution method in redox conditions, as previously described, and purified by ion exchange chromatography [10]. rPvDBP-RII was capable of binding to Duffy+ erythrocytes but not to cells which had been previously treated with chymotrypsin. Antibodies produced in mice managed to inhibit PvDBP variants (PvO, PvAH and PvP) binding to the DARC receptor with the same efficiency, thereby validating its functional activity.

As described, rPvDBP-RII has been expressed and obtained by using eukaryote and prokaryote expression systems. However, the technology required for replicating the methods described above and producing a sufficient amount of rPvDBP-RII is extremely expensive and/or complex and require several lengthy and labor-intensive steps. The present work was thus aimed at expressing and obtaining two PvDBP recombinant regions (RII and RIII/V) using the pEXP5-CT vector and the E. coli prokaryote expression system, in soluble form, completely functional and avoiding the commonly used denaturation and refolding steps.


Designing primers and amplifying dbp gene regions by PCR

Two sets of specific primers for amplifying P. vivax PvDBP protein RII (forward: 5′ ATGTCGAATGGTGGCAATCCT 3′; reverse: 5′ GGTGGCCTGAGATTTAGC 3′) and RIII/V (forward: 5′ ATGGCTAAAAATGTTGATCCGCA 3′; reverse 5′ GTTAGTTGTATCATTAGTAGTT 3′) fragments were manually designed (using Gene runner software, version 3.05) on a pvdbp gene sequence from the Salvador-I (Sal-I) reference strain reported in the PlasmoDB database (Gene ID: PVX_110810) [11, 12]. The gDNA (50 ng) from P. vivax Colombia Guaviare 1 (VCG-I) strain parasites (propagated as described previously [13]) was then used as template for 25 µL PCR reactions containing 1× enzyme, 2× KAPA HiFi HotStart ReadyMix (KAPA Biosystems, Woburn, MA, USA), 0.3 µM of primers and ultrapure water until reaction volume was completed. PCR for amplifying pvdbp fragments began with a denaturing step at 95 °C for 5 min, followed by 35 cycles at 98 °C for 20 s, 56 °C for 15 s and 72 °C for 1 min and a final extension step at 72 °C for 5 min. PCR products were purified using a Wizard PCR Clean-Up System kit (Promega, Madison, USA), ligated into pEXP5-CT/TOPO expression vector (Invitrogen, Carlsbad, USA) and then transformed in TOP-10 E. coli cells (Invitrogen).

Several recombinant clones were grown for 16 h at 37 °C at 270 rpm in Luria Bertani (LB) medium, supplemented with ampicillin (100 µg/mL), using a Lab-line Incubator Shaker. This was followed by plasmid DNA extraction using an UltraClean mini plasmid prep purification kit (MO BIO Laboratories, California, USA). After confirming the integrity of the clones obtained from the primate-adapted VCG-I strain using a ABI-3730 XL sequencer (Macrogen, Seoul, South Korea), the consensus sequence was compared to the sequence reported for the Sal-I strain dbp gene using ClustalW NPS software [14].

PvDBP fragment expression

Recombinant plasmids pEXP5-pvdbp-rii and pEXP5-pvdbp-riii/v were transformed in E. coli BL21-AI cells (Invitrogen), following the manufacturer’s recommendations. The cells were grown for 16 h at 37 °C, at 270 rpm, in 50 mL LB medium containing 100 µg/mL ampicillin. The next day, 1 L LB medium containing ampicillin was added to the initial culture, left in 1:20 dilution and then incubated in the same growth conditions as those mentioned above. Once ~ 0.8 OD600 had been reached, the cultures were incubated on ice for 30 min and 0.2% (w/v) l-arabinose (Sigma-Aldrich, St. Louis, USA) was added to induce expression for 16 h at room temperature (RT), with shaking at 200 rpm. A 1 mL aliquot of culture was used for evaluating protein expression by Western blot (see below). Bacteria were recovered by spinning at 2400×g for 20 min and the cell pellet was used for protein extraction.

Native and denaturing extraction methods

The E. coli BL21-AI culture pellet was submitted to three freezing (15 min at − 80 °C)/thawing (30 min on ice) cycles. It was then homogenized in native extraction buffer (NEB) containing 50 mM Tris, 300 mM NaCl, 25 mM imidazole, 0.1 mM EGTA and 0.25% Tween-20, at pH 8.0, and incubated for 1 h at 4 °C with constant shaking at 10 rpm using a tube rotator (Fisher Scientific, Waltham, USA). The soluble proteins (named rPvDBP-RIIS and rPvDBP-RIII/VS) were recovered from supernatant by spinning at 16,000×g for 1 h at 10 °C. Regarding the denaturing extraction method, the cell pellet was homogenized in denaturing extraction buffer (DEB) (6 M urea, 20 mM imidazole, 10 mM Tris–Cl, 100 mM NaH2PO4) to solubilize the IB; DEB was supplemented with a SIGMAFAST protease inhibitor cocktail tablet (Sigma Aldrich). The pellet was then treated with 0.1 mg/mL lysozyme overnight at 4 °C with shaking at 10 rpm. The extracted proteins (rPvDBP-RIIIB and rPvDBP-RIII/VIB) were recovered by spinning at 16,000×g for 1 h at 10 °C.

Protein purification

The supernatants derived from total cell lysate were incubated overnight at 4 °C with Ni2+-NTA resin (Qiagen, Valencia, CA, USA) pre-equilibrated with NEB or DEB for purification by solid-phase affinity chromatography. The resin-protein mixture was then poured onto a chromatography column and washed with 20 mL buffer containing 0.1% Triton X-114 for eluting bacterial endotoxin, followed by 50 mL of the same buffer without detergent to detach weakly-bound proteins from the resin (contaminating molecules). Proteins were eluted with PBS containing increasing concentrations of imidazole (50, 100, 250 and 500 mM) in 3 mL fractions. Regarding proteins extracted from the IB, a dialysis step was made before elution, involving several washes with DEB containing urea in decreasing concentrations (3, 1.5, 0.75, 0.37 M and PBS). After fractions had been collected, they were analyzed by 12% SDS-PAGE and Western blot; those having a single band were dialyzed exhaustively in PBS at pH 7.2 (36 h with PBS being replaced every 4 h). The proteins were ultra-filtered, concentrated with Amicon Ultra-4 centrifugal filters (Merck Millipore, Darmstadt, Germany) and then quantified using a micro BCA protein assay kit (Thermo Scientific, Rockford, USA).

SDS-PAGE and Western blot

The recombinant proteins contained in each fraction were treated in reducing conditions and then separated by weight on 12% polyacrylamide gel electrophoresis containing or lacking SDS, at 125 v for 2 h. The proteins were then transferred to a nitrocellulose membrane for 2 h at 10 v using Bio-Rad’s Trans-Blot SD semi-dry electrophoretic transfer cell. The membrane was washed 3 times with PBS solution containing 0.05% Tween (PBS-Tween) and then blocked for 1 h at RT with 5% (w/v) milk solution prepared in the same buffer. After 1 h incubation with peroxidase-conjugated monoclonal anti-polyhistidine antibody at a 1:4500 dilution (Sigma catalogue A7058), the reaction was revealed using a peroxidase substrate kit (Vector Laboratories, Burlingame, Canada), following the manufacturer’s recommendations. Each recombinant protein’s (rPvDBP-RII and rPvDBP-RIII/V) molecular mass was determined by linear regression using an XL-OptiProtein molecular weight marker (New England Biolabs, Ipswich MA, USA) as reference.

Circular dichroism analysis

The structural features of rPvDBP-RII and rPvDBP-RIII/V obtained using freezing/thawing or denaturing methods were analyzed by circular dichroism (CD) in the Fundación Instituto de Inmunología de Colombia’s (FIDIC) chemistry laboratory. This required eliminating excess salts from each molecule by dialyzing 150 µg exhaustively in deionized water using a 6–8000 Dalton molecular weight cut-off (MWCO) (Spectra/Por Membrane, Spectrum Laboratories Inc.). A Jasco J-810 (JASCO Inc.) was used for CD analysis of spectra from three different batches of molecules, an average of three sweeps were taken at 20 nm/min. Spectra Manager software was used for processing the data and then analyzed using CDSSTR deconvolution software [15].

Processing umbilical cord blood samples

Newborn umbilical cord blood (UCB) samples were collected by personnel from the Instituto de Ciencia, Biotecnología e Innovación en Salud (IDCBIS) in Bogotá, Colombia. White blood cells were then eliminated using the SEPAX system (Biosafe, Eysins, Switzerland) and their removal was confirmed by Wright staining, scanning 20 fields, using 100× objective. Duffy phenotype was typed by agglutination assay; this involved 5% erythrocytes homogenized in PBS being incubated with anti-Fya or anti-Fyb antibodies (Ortho Clinical Diagnostics, Raritan, USA) for 15 min at 37 °C. After three PBS washes, cells were mixed with anti-human anti-IgG antibody and were then spun for 15 s at 1000×g. Agglutination was determined macroscopically by homogenizing each sample following the centrifugation step.

Human reticulocyte binding assay

Flow cytometry was used for evaluating rPvDBP-RII and rPvDBP-RIII/V binding to human reticulocytes, in three independent assays. Briefly, 5 μL Duffy positive (FyaFyb+, according to agglutination assay) UCB sample was incubated with 25 μg of each recombinant protein (rPvDBP-RIIS, rPvDBP-RIIIB, rPvDBP-RIII/VS and rPvDBP-RIII/VIB) for 16 h at 4 °C with shaking at 4 rpm. Following three washes with PBS containing 1% bovine serum albumin (BSA), the cells were incubated with phycoerythrin (PE) conjugated anti-histidine antibodies (MACS molecular-Miltenyi Biotec, San Diego CA, USA) in 1:40 dilution, allophycocyanin (APC-H7) conjugated mouse anti-human CD71 (Becton–Dickinson, Franklin Lakes NJ, USA) in 1:80 dilution and mouse anti-human CD45-APC (Becton–Dickinson) in 1:80 dilution for 20 min at RT in the dark. The percentage of recombinant binding to mature (normocytes) (CD71CD45) or immature (reticulocytes) (CD71+CD45) erythrocytes was quantified from 1 million events acquired on a FACSCanto II cytometer (BD, San Diego CA, USA) and analyzed using FlowJo V10 software.

HABP location

The amino acid sequences for six reticulocyte-specific HABPs were taken from a study by Ocampo et al. [16]. The rPvDBP-RII 3D structure was searched in the protein data bank (PDB ID: 3RRC) [17], downloaded as a PDB file and visualized using Swiss-PdbViewer 4.1.0 software [18]. The HABPs were then sought manually and shown in different colors for locating them on the rPvDBP-RII 3D model.

Statistical analysis

Each binding assay’s mean and standard deviation were calculated from the data provided by three independent experiments. GraphPad Software (San Diego CA, USA) was used for statistical analysis (Student’s t test); differences were compared between each group, using a 0.05 significance level for testing the proposed hypothesis.


PvDBP has human reticulocyte binding and non-binding regions

Selecting PvDBP binding controls for protein–cell interaction assays was based on that reported in the literature. Briefly, two P. vivax dbp gene (pvdbp) regions were selected for amplifying, cloned inside the pEXP5-CT vector and then transformed in TOP10 E. coli bacteria; these were pvdbp-rii and pvdbp-riii/v. pvdbp-rii (bp 553–1596 according the Sal-I strain sequence reported in GenBank) encoding the cysteine-rich domain (rPvDBP-RII: aa 185–532) which can cause erythrocyte rosette formation when expressed on COS-7 cell surface [5]. This domain also had various high activity binding peptides (HABPs) specific for human reticulocytes (immature erythrocytes) [16], while the pvdbp-riii/v amplified region (bp 1792–2487) encoding a fragment that had no interaction whatsoever with the cells tested (rPvDBP-RIII/V: aa 598–829) (Fig. 1) [5, 16].
Fig. 1
Fig. 1

Selecting and expressing pvdbp gene fragments. The amplification of binding (pvdbp-rii: 553–1596 bp) and non-binding regions (pvdbp-riii/v: bp 1792–2487) encoding rPvDBP-RII (aa 185–532) and rPvDBP-RIII/V (aa 598–829). PvDBP minimal reticulocyte binding regions are shown in dark grey; a region having normocyte and reticulocyte binding activity is shown in light grey. Agarose gel: lane 1 is the molecular weight marker. Lane 2 indicates PCR amplification of pvdbp-rii (1047 bp) and pvdbp-riii/v (699 bp) fragments. Western blot and SDS-PAGE: the molecular weight marker is shown (MW kDa), as are the molecules extracted from the soluble fraction (S) and/or inclusion bodies (IB) and purified (P)

As can be observed, a greater than 1000 bp product was obtained by PCR from the pvdbp-rii fragment and another 700 bp product from the pvdbp-riii/v fragment using gDNA from the P. vivax VCG-I strain, having the expected size: 1047 bp for pvdbp-rii and 699 bp for pvdbp-riii/v (Fig. 1: agarose gel electrophoresis). After obtaining the pEXP5-CT-pvdbp-rii and pEXP5-CT-pvdbp-riii/v recombinant vectors, each clone was sequenced and compared to the aa sequence of each fragment encoding rPvDBP-RII and rPvDBP-RIII/V among P. vivax Sal-I and VCG-I strains. Alignment gave three non-synonymous substitutions in c.1016A > G (p.Asp339Gly), c.1034G > A (p.Arg345His) and c.1373T > A (p.Ile458Lys) located in PvDBP-RII while no mutation was observed in PvDBP-RIII/V which was consistent with another report stating that region II has been seen to be variable among parasite strains from Madagascar, Ethiopia, India and Brazil [19].

rPvDBP-RII and rPvDBP-RIII/V were obtained in soluble form in E. coli

The molecules were successfully expressed in the E. coli system and also extracted using freezing/thawing or denaturing method (Fig. 1: Western blot). The greatest amount of rPvDBP-RII and rPvDBP-RIII/V was extracted from the IB (rPvDBP-RIIIB and rPvDBP-RIII/VIB), this being consistent with other studies where the PvDBP-RII was predominantly found in the insoluble fraction [7, 9, 10]. The molecule’s purification was determined by Coomassie blue gel staining. As can be seen, the mobility of recombinants treated with non-reducing conditions in SDS-PAGE was consistent with each one’s expected molecular weight: 42 kDa for rPvDBP-RII and 16 kDa for rPvDBP-RIII/V (Fig. 1: SDS-PAGE). On average, the amount of molecule extracted by the freezing/thawing method (named here rPvDBP-RIIS and rPvDBP-RIII/VS) was: 152 µg/L of rPvDBP-RIIS and 479 µg/L of rPvDBP-RIII/VS, and 267 µg/L of rPvDBP-RIIIB and 684 µg/L of rPvDBP-RIII/VIB for the denaturing method.

rPvDBP-RIIS and rPvDBP-RIII/VS mainly consisted of α-helices

Each molecule’s secondary structure and folding properties were evaluated by CD spectroscopy. The spectra for rPvDBP-RIIS and rPvDBP-RIII/VS (but not for rPvDBP-RIIIB and rPvDBP-RIII/VIB) showed a characteristic α-helical conformation pattern, characterized by having a 192 nm maxima and 208 and 222 nm minima (Fig. 2). CDSSTR deconvolution software analysis for determining structural elements showed that rPvDBP-RIIS consisted of 76.8% α-helices, 11.1% β-sheets and 5.9% β-turns while rPvDBP-RIII/VS had 67.3% α-helices, 11.5% β-sheets and 7.4% β-turns.
Fig. 2
Fig. 2

CD spectra of two PvDBP-derived recombinant proteins. The CD spectra for rPvDBP-RII (a) and rPvDBP-RIII/V (b) obtained from soluble (S) (blue line) or inclusion body (IB) (red line) fractions

rPvDBP-RIIS and rPvDBP-RIII/VS binding to reticulocytes and normocytes

Protein–cell interaction was evaluated by flow cytometry, using rPvDBP-RII and rPvDBP-RIII/V obtained from each extraction method (freezing/thawing or denaturing) and white cell-depleted newborn umbilical cord blood. There was a displacement in the histogram when comparing rPvDBP-RIIS binding to human reticulocytes (CD71+CD45) unlike rPvDBP-RIIIB (Fig. 3a) (t test: t(4) = 30.50, P = 0.001). Regarding rPvDBP-RIII/VS and rPvDBP-RIII/VIB, there was no statistical difference concerning binding compared to negative control (rPvDBP-RIII/VS: t test: t(4) = 2.13, P = 0.100; rPvDBP-RIII/VIB: t test: t(4) = 1.79, P = 0.147). Particularly interesting was the fact that rPvDBP-RIIS bound more to reticulocytes (CD71+CD45) (15.1% ± 1.06) compared to normocytes (CD71CD45) (0.72% ± 0.08) (Fig. 3b). Furthermore, rPvDBP-RIIS binding to human reticulocytes was greater than that observed for rPvDBP-RIII/VS (t test: t(4) = 30.80, P = 0.001) and increased in a concentration-dependent manner, becoming saturated at 1.2 µM (Fig. 4a).
Fig. 3
Fig. 3

rPvDBP-RII and rPvDBP-RIII/V erythrocyte binding activity. a A representative histogram from two independent experiments showing the PE signal (α-His-PE+) for reticulocyte binding assay using rPvDBP-RII and rPvDBP-RIII/V extracted from soluble (S) or inclusion body (IB) fractions compared to control (CD71+CD45PE). b rPvDBP-RIIS and rPvDBP-RIII/VS human normocyte (N) and reticulocyte (R) binding percentages. A characteristic dot plot used for building the bar chart is shown at the bottom of the figure

Fig. 4
Fig. 4

rPvDBP-RII saturation (a) and binding site location (b) analysis. a The protein concentration (x axis) and reticulocyte (CD71+CD45) binding percentage. b HABPs location on rPvDBP-RII 3D structure is shown in different colors

rPvDBP-RIIS reticulocyte binding correlates with its α-helical content

rPvDBP-RII 3D structure was analyzed for localizing each HABP to reticulocytes reported in the literature [16], using Swiss-PdbViewer software [18]. Analysis of rPvDBP-RII minimal binding regions overlapping in the 3D structure of the molecule reported in the PBD database [17], revealed that most had an α-helical structure (Fig. 4b), suggesting that rPvDBP-RIIS reticulocyte binding activity is correlated with its structural features (mainly α-helical content).


An in-depth understanding of parasite-host interactions is important to comprehend the complex machinery involved in some microorganisms’ invasion of their target cells and thus establish appropriate control methods. Concerning P. vivax, parasite protein interactions with their target cells (reticulocytes) has been studied with molecules obtained from eukaryote (i.e. Sf insect cells [7, 20], COS-7 cells [21], or wheat germ cell-free system [22]) or prokaryote (mainly E. coli) [23, 24] systems; the latter has been most used due to its methodological and economic advantages. In spite of the forgoing, the greatest challenge in using the E. coli system lies in the difficulty in obtaining functional molecules. An easy-to-use, fast and economic technique for producing and extracting two controls which would be useful regarding protein–cell interaction techniques was thus standardized here; it was based on screening a molecule which is important for P. vivax binding to human reticulocytes.

This strategy consisted of selecting DBP for expressing and obtaining binding (rPvDBP-RII) and non-binding (rPvDBP-RIII/V) fragments in the E. coli system [5, 16] (Fig. 1). The pEXP5-CT/TOPO vector was thus used since it contains a high-level T7 inducible promoter, a pUC origin for plasmid high-copy replication and maintenance in E. coli, an efficient cloning site and a C-terminal fusion tag for detecting and purifying recombinant fusion proteins. In spite of the problem regarding insolubility which has been reported when the rPvDBP-RII is expressed in E. coli [7, 9], it was obtained, as well as the III/V region, using the freezing/thawing process (Fig. 1). This was probably due to the incubation conditions used here (25 °C for 16 h), since it has been reported that a smaller amount of IB is produced as the temperature becomes reduced, thereby favoring soluble protein production [25, 26]. Even though a greater amount of rPvDBP-RIIIB and rPvDBP-RIII/VIB was obtained, these molecules did not have a characteristic α-helix structure pattern compared to rPvDBP-RIIS and rPvDBP-RIII/VS (Fig. 2), supporting the notion that extensive dialysis with PBS is not enough for recovering an appropriate structure for such molecules extracted from IB. This result highlighted the fact that the refolding method is essential for obtaining rPvDBP-RII (extracted from IB) in fully functional form, as has been described by Singh et al. [9]. Thus, even though the advantage of expression in IB lies in producing a greater amount of the molecule, correct protein folding is difficult to recover by a common dialysis method.

The molecule’s human erythrocyte binding activity was determined and quantified by flow cytometry to investigate whether structure played an important role in such function. Duffy+ (FYaFYb+) human blood (P. vivax preferred population [27]) was used for this and antibodies directed against each recombinant protein (anti-His-PE) or against the reticulocyte population (anti-CD71-APC-H7) and white blood cells (anti-CD45-APC). The transferrin receptor (CD71) was used as reticulocyte marker, as previously reported [27], while CD45 receptor labelling was included in the assay so as to exclude activated lymphocytes from the analysis (they express CD71 on their surface also, but contrary to reticulocytes, they are CD45+). The molecules extracted by freezing/thawing process were capable of binding target cells, unlike those extracted using the denaturing method (Fig. 3). A greater percentage of rPvDBP-RIIS bound to human reticulocytes rather than normocytes (Fig. 3a), which can be substantiated by the fact that it consists of six reticulocyte HABPs, as demonstrated by Ocampo et al. [16]. Regarding rPvDBP-RIII/VS, its binding was similar to that demonstrated for control (CD71+CD45PE cells), coinciding with previous studies showing that the region expressed on COS-7 cell surface did not cause rosette formation or have reticulocyte or normocyte HABPs [5, 16]. The fact that only rPvDBP-RIIS (77% α-helix content) bound to reticulocytes but not rPvDBP-RIIIB (which did not show a characteristic α-helix structure) highlighted that the secondary structure was important for the molecule’s binding activity.

The 3D structure reported by Batchelor et al. [28] was thus analyzed for locating structural elements and determining whether they could have any importance regarding binding by comparing them with previously identified rPvDBP-RII minimal binding regions [16] (Fig. 1). Interestingly, it was observed that most rPvDBP-RII HABPs reported have α-helix structures (Fig. 4b) which, added to the CD analysis and protein–cell interaction here reported (Figs. 2, 3), suggest that such structures are extremely important for rPvDBP-RIIS human reticulocyte binding activity; these structures could be affected by treatment with urea, as reported in this and previous studies [7, 8].

The forgoing supports the idea that the methodology described here could be used for obtaining parasite molecules in soluble and functional form, as described recently [2931] avoiding the denaturation and refolding steps commonly used. However, it does not mean that this should become a rule for all P. vivax proteins, because it has also been shown that some of them can be obtained functionally from IB, such as some molecules belonging to the Pv-fam-a [23], PvTRAg [24] and PvRON families [31]. The results highlight rPvDBP-RIIS and rPvDBP-RIII/VS as optimal controls to be used in P. vivax protein-target cell interaction assays. Given that no negative control such as rPvDBP-RIII/V has been studied in detail to date by rosetting assay [5], screening minimal binding regions [16] and/or flow cytometry (shown here), this could be useful to establish a baseline regarding the positive interaction between parasite proteins and their target cells.


The methodology described may provide a starting point for P. vivax protein production and extraction in soluble form, with a proper folding in the E. coli system; it could be useful in biotechnological applications. This is the first report showing how the rPvDBP-RII domain can be obtained in soluble form avoiding denaturation and refolding steps and also highlighting the usefulness of the rPvDBP-RIII/V fragment as a non-binding control in protein–cell interaction assays. This methodology could be used for determining the capability of various P. vivax molecules to bind to human reticulocytes and thus screen their proteins or regions which could be used as components of a vaccine against the species.



Plasmodium vivax Duffy binding protein


Duffy antigen receptor for chemokines


region II






high activity binding peptide


circular dichroism




inclusion bodies


Salvador I


Plasmodium vivax dbp




Vivax Colombia Guaviare 1


room temperature


native extraction buffer


denaturing extraction buffer


Fundación Instituto de Inmunología de Colombia


Duffy positive


Authors’ contributions

DAMP devised and designed the study; DAMP, LAB, MB, LAGM and YV performed the experiments; DAMP and MAP analyzed the results; DAMP and MAP wrote the manuscript. All authors read and approved the final manuscript.


We would like to thank Ana María Perdomo and Bernardo Camacho from the Instituto de Ciencia, Biotecnología e Innovación en Salud (IDCBIS) in Bogotá for supplying the umbilical cord blood, Diana Granados and Diana Díaz for technical support in cytometry and Jason Garry for translating this manuscript.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

All data generated or analyzed during this study is included within this article.

Consent for publication

Not applicable.

Ethics approval and consent to participate

The newborn umbilical cord blood samples used in this research were collected by the Instituto de Ciencia, Biotecnología e Innovación en Salud (IDCBIS) in Bogotá. All individuals (progenitors regarding umbilical cord samples) signed an informed consent form after having received detailed information regarding the study’s goals. All procedures were approved by FIDIC’s ethics committee.


This research was financed through the Departamento Administrativo de Ciencia, Tecnología e Innovación (COLCIENCIAS), contract RC#309-2013. MB was financed by the Project “Formación de talento humano de alto nivel” approved by the “Fondo de Ciencia, Tecnología e Innovación” (CTeI) from the “Sistema General de Regalías” (SGR)—BPIN 2013000100103, Gobernación del Tolima y Universidad del Tolima, Colombia. The sponsors had no role in study design or data collection, analysis and/or interpretation.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

Molecular Biology and Immunology Department, Fundación Instituto de Inmunología de Colombia (FIDIC), Carrera 50 No. 26–20, Bogotá, DC, Colombia
Livestock Sciences Faculty, Universidad de Ciencias Aplicadas y Ambientales (U.D.C.A), Calle 222 No. 55–37, Bogotá, DC, Colombia
Receptor-Ligand Department, Fundación Instituto de Inmunología de Colombia (FIDIC), Carrera 50, No. 26–20, Bogotá, Colombia
Chemical Synthesis Department, Fundación Instituto de Inmunología de Colombia (FIDIC), Carrera 50 No. 26–20, Bogotá, DC, Colombia
Basic Sciences Department, School of Medicine and Health Sciences, Universidad del Rosario, Carrera 24 No. 63C-69, Bogotá, DC, Colombia


  1. Satchwell TJ. Erythrocyte invasion receptors for Plasmodium falciparum: new and old. Transfus Med. 2016;26:77–88.View ArticlePubMedGoogle Scholar
  2. Miller LH, Mason SJ, Clyde DF, McGinniss MH. The resistance factor to Plasmodium vivax in blacks: the Duffy-blood-group genotype, FyFy. N Engl J Med. 1976;295:302–4.View ArticlePubMedGoogle Scholar
  3. Horuk R, Chitnis CE, Darbonne WC, Colby TJ, Rybicki A, Hadley TJ, et al. A receptor for the malarial parasite Plasmodium vivax: the erythrocyte chemokine receptor. Science. 1993;261:1182–4.View ArticlePubMedGoogle Scholar
  4. Adams JH, Sim BK, Dolan SA, Fang X, Kaslow DC, Miller LH. A family of erythrocyte binding proteins of malaria parasites. Proc Natl Acad Sci USA. 1992;89:7085–9.View ArticlePubMedPubMed CentralGoogle Scholar
  5. Chitnis CE, Miller LH. Identification of the erythrocyte binding domains of Plasmodium vivax and Plasmodium knowlesi proteins involved in erythrocyte invasion. J Exp Med. 1994;180:497–506.View ArticlePubMedGoogle Scholar
  6. Ranjan A, Chitnis CE. Mapping regions containing binding residues within functional domains of Plasmodium vivax and Plasmodium knowlesi erythrocyte-binding proteins. Proc Natl Acad Sci USA. 1999;96:14067–72.View ArticlePubMedPubMed CentralGoogle Scholar
  7. Dutta S, Daugherty JR, Ware LA, Lanar DE, Ockenhouse CF. Expression, purification and characterization of a functional region of the Plasmodium vivax Duffy binding protein. Mol Biochem Parasitol. 2000;109:179–84.View ArticlePubMedGoogle Scholar
  8. Fraser T, Michon P, Barnwell JW, Noe AR, Al-Yaman F, Kaslow DC, et al. Expression and serologic activity of a soluble recombinant Plasmodium vivax Duffy binding protein. Infect Immun. 1997;65:2772–7.PubMedPubMed CentralGoogle Scholar
  9. Singh S, Pandey K, Chattopadhayay R, Yazdani SS, Lynn A, Bharadwaj A, et al. Biochemical, biophysical, and functional characterization of bacterially expressed and refolded receptor binding domain of Plasmodium vivax duffy-binding protein. J Biol Chem. 2001;276:17111–6.View ArticlePubMedGoogle Scholar
  10. Bhardwaj R, Shakri AR, Hans D, Gupta P, Fernandez-Becerra C, Del Portillo HA, et al. Production of recombinant PvDBPII, receptor binding domain of Plasmodium vivax Duffy binding protein, and evaluation of immunogenicity to identify an adjuvant formulation for vaccine development. Protein Expr Purif. 2015;136:52–7.View ArticlePubMedGoogle Scholar
  11. Bozdech Z, Mok S, Hu G, Imwong M, Jaidee A, Russell B, et al. The transcriptome of Plasmodium vivax reveals divergence and diversity of transcriptional regulation in malaria parasites. Proc Natl Acad Sci USA. 2008;105:16290–5.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Aurrecoechea C, Brestelli J, Brunk BP, Dommer J, Fischer S, Gajria B, et al. PlasmoDB: a functional genomic database for malaria parasites. Nucleic Acids Res. 2009;37:D539–43.View ArticlePubMedGoogle Scholar
  13. Pico de Coana Y, Rodriguez J, Guerrero E, Barrero C, Rodriguez R, Mendoza M, et al. A highly infective Plasmodium vivax strain adapted to Aotus monkeys: quantitative haematological and molecular determinations useful for P. vivax malaria vaccine development. Vaccine. 2003;21:3930–7.View ArticlePubMedGoogle Scholar
  14. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–80.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Sreerama N, Woody RW. Estimation of protein secondary structure from circular dichroism spectra: comparison of CONTIN, SELCON, and CDSSTR methods with an expanded reference set. Anal Biochem. 2000;287:252–60.View ArticlePubMedGoogle Scholar
  16. Ocampo M, Vera R, Eduardo Rodriguez L, Curtidor H, Urquiza M, Suarez J, et al. Plasmodium vivax Duffy binding protein peptides specifically bind to reticulocytes. Peptides. 2002;23:13–22.View ArticlePubMedGoogle Scholar
  17. Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, et al. The protein data bank. Nucleic Acids Res. 2000;28:235–42.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Guex N, Peitsch MC. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis. 1997;18:2714–23.View ArticlePubMedGoogle Scholar
  19. Gunalan K, Lo E, Hostetler JB, Yewhalaw D, Mu J, Neafsey DE, et al. Role of Plasmodium vivax Duffy-binding protein 1 in invasion of Duffy-null Africans. Proc Natl Acad Sci USA. 2016;113:6271–6.View ArticlePubMedPubMed CentralGoogle Scholar
  20. Cantor EM, Lombo TB, Cepeda A, Espinosa AM, Barrero CA, Guzman F, et al. Plasmodium vivax: functional analysis of a highly conserved PvRBP-1 protein region. Mol Biochem Parasitol. 2001;117:229–34.View ArticlePubMedGoogle Scholar
  21. Ntumngia FB, Thomson-Luque R, Torres Lde M, Gunalan K, Carvalho LH, Adams JH. A novel erythrocyte binding protein of Plasmodium vivax suggests an alternate invasion pathway into Duffy-positive reticulocytes. MBio. 2016;7:e01261-16.View ArticlePubMedPubMed CentralGoogle Scholar
  22. Han JH, Lee SK, Wang B, Muh F, Nyunt MH, Na S, et al. Identification of a reticulocyte-specific binding domain of Plasmodium vivax reticulocyte-binding protein 1 that is homologous to the PfRh4 erythrocyte-binding domain. Sci Rep. 2016;6:26993.View ArticlePubMedPubMed CentralGoogle Scholar
  23. Zeeshan M, Tyagi RK, Tyagi K, Alam MS, Sharma YD. Host-parasite interaction: selective Pv-fam-a family proteins of Plasmodium vivax bind to a restricted number of human erythrocyte receptors. J Infect Dis. 2015;211:1111–20.View ArticlePubMedGoogle Scholar
  24. Tyagi RK, Sharma YD. Erythrocyte binding activity displayed by a selective group of Plasmodium vivax tryptophan rich antigens is inhibited by patients’ antibodies. PLoS ONE. 2012;7:e50754.View ArticlePubMedPubMed CentralGoogle Scholar
  25. de Groot NS, Ventura S. Effect of temperature on protein quality in bacterial inclusion bodies. FEBS Lett. 2006;580:6471–6.View ArticlePubMedGoogle Scholar
  26. Hartinger D, Heinl S, Schwartz HE, Grabherr R, Schatzmayr G, Haltrich D, et al. Enhancement of solubility in Escherichia coli and purification of an aminotransferase from Sphingopyxis sp. MTA144 for deamination of hydrolyzed fumonisin B(1). Microb Cell Fact. 2010;9:62.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Malleret B, Li A, Zhang R, Tan KS, Suwanarusk R, Claser C, et al. Plasmodium vivax: restricted tropism and rapid remodeling of CD71-positive reticulocytes. Blood. 2015;125:1314–24.View ArticlePubMedPubMed CentralGoogle Scholar
  28. Batchelor JD, Zahm JA, Tolia NH. Dimerization of Plasmodium vivax DBP is induced upon receptor binding and drives recognition of DARC. Nat Struct Mol Biol. 2011;18:908–14.View ArticlePubMedPubMed CentralGoogle Scholar
  29. Baquero LA, Moreno-Perez DA, Garzon-Ospina D, Forero-Rodriguez J, Ortiz-Suarez HD, Patarroyo MA. PvGAMA reticulocyte binding activity: predicting conserved functional regions by natural selection analysis. Parasit Vectors. 2017;10:251.View ArticlePubMedPubMed CentralGoogle Scholar
  30. Moreno-Perez DA, Baquero LA, Chitiva-Ardila DM, Patarroyo MA. Characterising PvRBSA: an exclusive protein from Plasmodium species infecting reticulocytes. Parasit Vectors. 2017;10:243.View ArticlePubMedPubMed CentralGoogle Scholar
  31. Arevalo-Pinzon G, Bermudez M, Curtidor H, Patarroyo MA. The Plasmodium vivax rhoptry neck protein 5 is expressed in the apical pole of Plasmodium vivax VCG-1 strain schizonts and binds to human reticulocytes. Malar J. 2015;14:106.View ArticlePubMedPubMed CentralGoogle Scholar


© The Author(s) 2018


By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate. Please note that comments may be removed without notice if they are flagged by another user or do not comply with our community guidelines.
