- Methodology
- Open access
- Published:
A yeast expression system for functional and pharmacological studies of the malaria parasite Ca2+/H+ antiporter
Malaria Journal volume 11, Article number: 254 (2012)
Abstract
Background
Calcium (Ca2+) signalling is fundamental for host cell invasion, motility, in vivo synchronicity and sexual differentiation of the malaria parasite. Consequently, cytoplasmic free Ca2+ is tightly regulated through the co-ordinated action of primary and secondary Ca2+ transporters. Identifying selective inhibitors of Ca2+ transporters is key towards understanding their physiological role as well as having therapeutic potential, therefore screening systems to facilitate the search for potential inhibitors are a priority. Here, the methodology for the expression of a Calcium membrane transporter that can be scaled to high throughputs in yeast is presented.
Methods
The Plasmodium falciparum Ca2+/H+ antiporter (PfCHA) was expressed in the yeast Saccharomyces cerevisiae and its activity monitored by the bioluminescence from apoaequorin triggered by divalent cations, such as calcium, magnesium and manganese.
Results
Bioluminescence assays demonstrated that PfCHA effectively suppressed induced cytoplasmic peaks of Ca2+, Mg2+ and Mn2+ in yeast mutants lacking the homologue yeast antiporter Vcx1p. In the scalable format of 96-well culture plates pharmacological assays with a cation antiporter inhibitor allowed the measurement of inhibition of the Ca2+ transport activity of PfCHA conveniently translated to the familiar concept of fractional inhibitory concentrations. Furthermore, the cytolocalization of this antiporter in the yeast cells showed that whilst PfCHA seems to locate to the mitochondrion of P. falciparum, in yeast PfCHA is sorted to the vacuole. This facilitates the real-time Ca2+-loading assays for further functional and pharmacological studies.
Discussion
The functional expression of PfCHA in S. cerevisiae and luminescence-based detection of cytoplasmic cations as presented here offer a tractable system that facilitates functional and pharmacological studies in a high-throughput format. PfCHA is shown to behave as a divalent cation/H+ antiporter susceptible to the effects of cation/H+ inhibitors such as KB-R7943. This type of gene expression systems should advance the efforts for the screening of potential inhibitors of this type of divalent cation transporters as part of the malaria drug discovery initiatives and for functional studies in general.
Conclusion
The expression and activity of the PfCHA detected in yeast by a bioluminescence assay that follows the levels of cytoplasmic Ca2+ as well as Mg2+ and Mn2+ lend itself to high-throughput and quantitative settings for pharmacological screening and functional studies.
Background
Ca2+ signalling drives a myriad of events in the Plasmodium. falciparum life cycle. They include erythrocyte invasion [1–3], in vivo synchronicity in the erythrocytic cycle [4], together with sexual differentiation, motility and invasion by ookinetes and sporozoites in the mosquito vector [5–7]. As in any eukaryote the parasite’s concentration of cytosolic free Ca2+ is tightly maintained at 50-150 nM [8, 9]. In eukaryotes this is achieved by its active sequestration into various organelles and/or extrusion to extracellular space. Transporters that could mediate this activity in P. falciparum include two Ca2+ ATPases, a low-affinity transporter PfATP4 [10] and a higher affinity SERCA-like Ca2+ ATPase PfATP6 [11, 12]. Intracellular Ca2+ in Plasmodium has been found in acidic compartments (e.g. food vacuole with a calculated free Ca2+ of 0.4-2 μM) [9, 13, 14]. Ca2+ sequestration has also been observed in the malaria parasite’s mitochondrion [15, 16]. Besides Ca2+ pumps, low-affinity secondary transporters that facilitate the membrane transport of Ca2+ and other divalent cations (e.g. Mg2+, Mn2+) into organelles or through plasma membrane using a proton (in lower eukaryotes and plants) gradient in the opposite direction (Ca2+/H+ exchangers or antiporters) are known to mediate the dissipation of cytoplasmic peaks of Ca2+[17, 18]. In this context a P. falciparum Ca2+/H+ antiporter (PfCHA) homologue to the family of CAtion eXchangers (CAX, Transporter Classification Database 2.A.19.2) [19] has been reported and characterized in oocytes of X. laevis as a divalent cation (Ca2+, Mn2+ and possibly Mg2+)/H+ exchanger [20].
Saccharomyces cerevisiae is a highly developed and widely used model organism. Furthermore, S. cerevisiae has become a model for eukaryotic Ca2+ homeostasis [21, 22]. In the present work, PfCHA has been expressed in the yeast vcx1Δ (VaCuolar Ca2+/H+ eXchanger) gene knock-out mutant. A bioluminescence apoaequorin reporter system has been used to allow the detection of cytoplasmic Ca2+ in vcx1Δ where PfCHA is shown to be able to re-establish Ca2+ mobilisation from cytoplasm. In the apoaequorin system aequorin catalyses the oxidation of an imidazolopyrazinone (coelenterazine) upon Ca2+ binding and light is emitted from the oxidized and excited state of this chromophore that exists tightly bound to aequorin. In vitro, Ca2+ binding to apoaequorin triggers the emission of blue light (469 nm), although other activating cations such as trivalent lanthanides [23] and divalent Mn2+ and Mg2+ are also known to bind aequorin via three EF-hand Ca2+-binding sites [24].
Interestingly, whilst in the parasite PfCHA is reported to be sorted to the mitochondrion [20], in S. cerevisiae the exchanger is sorted to the vacuole. This finding offers further practical advantages for the studies of a membrane transporter such as PfCHA since yeast vacuoles are their main Ca2+ storage compartments. Yeast is an attractive organism for recombinant protein production as it combines highly developed genetic systems and ease of use with reductions in time and costs. Moreover, due to the challenging nature of expressing functional membrane proteins a yeast expression system for PfCHA is a valuable tool for further functional studies and pharmacological screens. To this extent, the 96-well format was used to further demonstrate divalent cation (i.e. Ca2+, Mg2+, Mn2+) transport by PfCHA in vcx1Δ yeast cells and present an inhibition assay with a cation antiporter inhibitor as a proof of concept of the opportunities offered by this expression system for the search of PfCHA inhibitors.
Methods
Gene cloning
Total RNA from P. falciparum 3D7 was extracted with Trizol (Invitrogen) following manufacturer’s protocol using parasites harvested from standard cultures [25]. Gene sequences used as reference were downloaded from PlasmoDB5.3 [26] and GenBank [27]. The polymerase chain reaction (PCR) product from total RNA for PFF0170w (PfCHA) was cloned in the pCRII-Topo vector (Invitrogen), and subcloned in the shuttle vectors of the pGREG series [28] between Not I and Bam HI restriction sites obtained from Euroscarf. Primers for PFF0170w were 5’-ATGGTTATGGGTAGAGTTC and 5’-TTATGATGTATCAAACCAG. The S. cerevisiae VCX1 gene was directly cloned into pGREG505 using the following primers: 5’-gaattcgatatcaagcttatcgataccgtcgacaGGCTGCTGATAGCAAATAAA and 5’- gcgtgacataactaattacatgactcgaggtcgacGAATTTCTGCGCTACTGTTC. pGREG505 vector has the LEU2 selectable marker and the GAL1 promoter. Escherichia coli TOP10 cells (Invitrogen) were routinely used as recombinant plasmids host. For bioluminescence measurements of cytosolic Ca2+ yeast cells were transformed with a plasmid carrying the aequorin gene [29]. This gene cloned in a pSEY8 plasmid under ADH3 promoter was kindly provided by David M. Bedwell (University of Alabama at Birmingham). Reverse transcription PCR and real-time PCR with iQ SYBR Green Supermix (Bio-Rad) in yeast were performed using total RNA extracted with RiboPure-Yeast (Ambion/Applied Biosystems, Austin, TX, USA) following manufacturer's instructions. cDNA was synthesized using ThermoScript (Invitrogen), and PCR amplifications using Platinum Taq High Fidelity (Invitrogen).
Yeast strains and media
Yeast Saccharomyces cerevisiae haploid strain Y03825 (MATa,his3Δ1,leu2Δ0,met15Δ0,ura3Δ0,YDL128w::kanMX4) was obtained from the European Saccharomyces cerevisiae Archives for Functional Analysis (Euroscarf) [30]. In Y03825 the Ca2+ antiporter gene VCX1 (YDL128w, [31]) is replaced by the kanMX4 gene that in yeast provides a geneticin (G418, Sigma G8168) resistant phenotype. BY4741n is the isogenic and haploid parental strain (Euroscarf Y00000). Yeast cells were transformed by the DMSO-based method [32]. Yeast were grown on complete YPD (yeast-peptone) medium with 2% (w/v) D-glucose, or minimal synthetic medium (SM) with 2% (w/v) glucose or 2% (w/v) galactose as carbon sources, and strain-specific required nutrients and 400 μg/ml G418 [33].
Apoaequorin luminescence assay
Apoaequorin assays were adapted from Miseta et al[34]. pSEY8 vector (pAEQ with a URA3 selection marker) expresses the soluble calcium-binding protein aequorin [29]. Cells carrying pSEY8 and the pGREG505 recombinant vectors were grown in SD and 2% (w/v) glucose until they reached exponential growth to 0.5-0.6 OD600/ml. The cultures were then washed twice in SD medium and grow a further four hours in SD with 2% (w/v) galactose to induced gene expression. Ten OD600 units of cells were resuspended in 180 μl of test medium –TM- (0.17% (w/v) YNB, 2 mM EGTA, 40 mM MES-Tris, pH 6.5) after two washes with the same medium. To equilibrate cytosolic aequorin with its allosteric group, 20 μl of 0.6 mM coelenterazine (Fluka Biochemica 07372) dissolved in methanol were added and the cell suspension incubated for 30 min at room temperature. Cells were then washed twice in TM. The final pellet was resuspended in 1 ml of TM and allowed to equilibrate for 30 min at room temperature. After detecting the baseline light emission 1 ml of 1 M of CaCl2 was added. Final concentrations of CaCl2 were 50 mM or 500 mM in 2 ml total volume. For the multi-well plate experiments 0.1 OD600 were plated in 0.1 ml volumes and 1 M of the divalent cation salts (CaCl2, MgCl2 or MnCl2) were added in 0.1 ml to make 0.5 M final concentrations in 0.2 ml total volume. Light emission was collected from the 2 ml assays with a CliniLumat Berthold luminometer at intervals of 2 seconds or from the 0.2 ml multi-well assays with a LumiStarOmega luminometer (BMG Labtech) plate reader at 0.5 seconds intervals. Where indicated the samples were incubated with dimethylsulphoxide (DMSO) alone or with Bafilomycin A1 dissolved in DMSO (1 μM final concentration, Sigma B1793) or KB-R7943 dissolved in DMSO (Calbiochem 420336) for 30 minutes at room temperature prior to the addition of CaCl2.
Indirect immunofluorescence assay (IFA)
Yeast membranes were extracted and purified as in Fisher et al[35]. Indirect immunofluorescence in yeast cells was performed as in Stearman et al[36]. Polyclonal IgG antibody Anti-PfCHA (0.568 mg/ml) was produced in rabbit by GenScript (Piscataway, NJ, USA) against a 14 aa synthetic peptide representing positions 73-86 in the amino terminal sequence of PfCHA and used at 1:100 dilutions. The Anti-actin antibody was purchased from Sigma (A2066) and used at 1:500 dilutions. The secondary antibody anti-rabbit IgG-FITC was also purchased from Sigma (F0382) and used at 1:1000 dilutions. Cells were mounted with VectaShield HardSetTM mounting medium (Vector Labs Burlingame, CA, USA) and observed in a confocal microscope Zeiss Axiovert 200 M (L5M 5Pascal laser modules). Propidium iodide (Fluka 70335) was used for nuclei localization at 10 μg/ml room temperature for 30 minutes after treating with 100 μg/ml of RNaseA for 30 minutes.
Results
PfCHA restores mobilization of cytoplasmic Ca2+ in Saccharomyces cerevisiae vcx1Δ
Yeast vcx1Δ has a significant defect in the rapid Ca2+ sequestration response to high cytosolic levels of this cation [34]. Recombinant pGREG505 vectors carrying PfCHA or yeast VCX1 genes as well as the empty vector control were transformed into vcx1Δ. For the detection of cytosolic Ca2+ by bioluminescence, these strains were subsequently transformed with a vector carrying the apoaequorin gene (pSEY8-AEQ). Positive colonies were selected for growth in the absence of leucine and uracil and in the presence of 400 μg/ml of geneticin in SD medium. The presence of the recombinant vectors was verified and their RNA expression monitored by reverse transcription and PCR amplification (Additional file 1). Expectedly, there is a relative low expression of the heterologous PfCHA gene in the vcx1Δ mutant in comparison to the native yeast VCX1 gene. Truncated gene transcription is a known phenomenon in yeast expressing AT-rich P. falciparum genes [37] and this is evident in the differential amplifications for fragments in comparison to full-length VCX1 and PfCHA genes (Additional file 1B). Nonetheless the bioluminescence assays as presented below showed that these levels of expression were sufficient to detect functional protein in the yeast vcx1Δ background.
The medium used to process cells for the apoaequorin bioluminescence assays contains 2 mM EGTA to reduce extracellular Ca2+ concentration in the test medium - TM (~6 μM [34]). Four different samples were examined: the parental isogenic and haploid strain BY4741n, the vcx1Δ mutant containing the pGREG505 vector only (vcx1Δ + p505), vcx1Δ carrying the recombinant pGREG505-VCX1 (vcx1Δ + VCX1), and vcx1Δ carrying the recombinant vector pGREG505 with PfCHA (vcx1Δ + PfCHA). All four strains responded with a sharp elevation in cytosolic Ca2+ levels when 50 mM CaCl2 was added (Figure 1A).
PfCHA rescues yeast Saccharomyces cerevisiae Ca2+/H+antiporter mutant. A. Apoaequorin bioluminescence of cytosolic Ca2+ following exposure to extracellular Ca2+. Light emission was initially recorded for 8 seconds in low Ca2+ medium. CaCl2 was subsequently added to 50 mM final concentration in 2 ml total volume. The luminescence recorded for 90 seconds is shown. BY4741n is the haploid isogenic yeast parental strain, vcx1 Δ + p505 is the vcx1 Δ knock-out carrying the pGREG505 plasmid only, vcx1 Δ + VCX1 and vcx1 Δ + PfCHA are the same knock-out strain but carrying recombinant plasmids with the homologueous VCX1 gene or the Plasmodium falciparum PfCHA gene, respectively. B. Apoaequorin luminescence measurements following a challenge with 500 mM extracellular CaCl2. Addition of CaCl2 is indicated by the arrows. Data represent means and standard deviations of three experiments (n=3).
Before the Ca2+ shock the luminescence of the samples were registered for 8 seconds to establish the basal line. As expected vcx1Δ mutant showed the highest peak of cytosolic Ca2+ level and the reference BY4741n strain presented the lowest signal with a 10-fold difference between them. Mutant vcx1Δ cells expressing the homologue VCX1 closely followed the Ca2+ levels of BY4741n. Significantly, vcx1 Δ cells expressing the heterologous PfCHA also followed the extrusion of cytosolic Ca2+ after the initial peak. Although as anticipated less efficiently than the homologue VCX1 gene (Figure 1A). The difference in the areas under the curve (AUC) between the cytosolic levels of Ca2+ in the mutant vcx1Δ carrying the plasmid control and the vcx1Δ carrying the recombinant plasmid with PfCHA was significant (p < 0.005, Student’s two-tailed test). Replacing D-galactose with D-glucose, and thereby inhibiting the transcription of genes under the GAL1 promoter of the pGREG505 vector, impaired the expression of both VCX1 and PfCHA (Additional file 2). The phenotype of the vcx1 Δ mutant and the different levels of rescue by VCX1 or PfCHA detected as cytosolic levels of Ca2+ were more apparent (p < 0.0001 and p < 0.001, respectively, Student’s two-tailed test) when even higher concentrations (500 mM) of CaCl2 were applied as external Ca2+ (Figure 1B).
Ca2+/H+ antiporters can be inhibited by interfering with the transmembrane H+- gradient [38] and thus PfCHA was expected to be sensitive to bafilomycin A1 a vacuolar-specific V-type ATPase inhibitor. Following a pre-incubation with bafilomycin A1 (1 mM, 30 minutes) Ca2+ shock experiments were carried out as described above with 500 mM CaCl2. For all the strains, bafilomycin A1 treatment resulted in a reduced ability of the yeast cells to recover from the Ca2+ challenge (Figure 2). The reference strain BY4741n showed a three-fold increased cytosolic Ca2+ peak (Figure 2A), while the vcx1Δ mutant peak response was slightly but not significantly higher in the presence of bafilomycin A1 (Figure 2A) than the DMSO control. As with the strain carrying the yeast Ca2+/H+ exchangers (p < 0.0001, Student’s two-tailed test), treatment with bafilomycin A1 also affected the ability of PfCHA-carrying yeast cells to recover from the Ca2+ challenge (p < 0.001, Student’s two-tailed test) (Figure 2B). Taken together, the described phenotype rescue experiments carried out with the yeast S. cerevisiae vcx1Δ mutant are indicative of the functional expression of the heterologous PfCHA. Consistent with its expected mechanism of transport PfCHA is dependent on a proton membrane gradient sensitive to the vacuolar-specific inhibitor bafilomycin A1.
PfCHA Ca2+/H + antiporter function in yeast is inhibited by bafilomycin A1. Cytoplasmic Ca2+ dependent apoaequorin luminescence was measured following pre-incubation with the V-type ATPase inhibitor bafilomycin A1 (BF). Inhibitor-free controls contained concentrations of solvent (DMSO) equivalent to the solvent present in the BF sample. A. Data from the parental BY4741n strain and the vcx1Δ mutant carrying the plasmid only (vcx1Δ + p505). B. vcx1Δ carrying the yeast VCX1 (vcx1Δ + VCX1) or PfCHA (vcx1Δ + PfCHA). Time of the addition of CaCl2 is indicated by the arrows. Data represent means of three experiments (n = 3).
Further functional studies in a scalable format
Yeast cultures of vcx1Δ carrying the pGREG505 vector only (vcx1Δ + p505) or the recombinant vectors pGREG505–VCX1 (vcx1Δ + VCX1) and pGREG505-PfCHA (vcx1Δ + PfCHA) were processed for apoaequorin assays as described in Methods. The parental strain BY4741n was not used for assays in the multi-well plates as the mutant carrying the homologue VCX1 gene behaved equivalently in the Ca2+ loading assays presented above. In 96-well plates yeast cells were distributed in 0.1 ml per well containing a number of cells equivalent to 0.1 OD unit (OD600). After establishing the base line for 5 seconds Ca2+, Mg2+ or Mn2+ were injected as 1 M chloride salts on to the selected wells (0.1 ml) to render 0.5 M final concentrations. The luminescence signals were recorded for 60 seconds at intervals of 0.5 seconds. The luminescence peaks were sharper and the area under the curves was smaller than those originated by the larger cell volumes and densities used previously with equivalent final concentrations of Ca2+ (Figure 1B). The dissipation of free cytosolic Ca2+ by Vcx1p and PfCHA was significant (p < 0.001 and p < 0.01, respectively, Student’s two-tailed test) by comparison to the vector only control demonstrating the functionality of the assays in the multi-well format (Figure 3A). Furthermore, the effective movement of free Mg2+ (Figure 3B) and Mn2+ (Figure 3C) from the cytosol by PfCHA was also apparent and significant (p < 0.01). Noteworthy, the initial functional characterization of PfCHA as a Ca2+ and Mn2+ transporter did not present direct transport activity of Mg2+ by PfCHA when expressed in X. laevis oocytes [20]. However, a lower affinity of PfCHA for Mg2+ was inferred from competition studies against 45Ca2+ transport. Here, the yeast expression system seems to substantiate the evidence of Mg2+ being a substrate for PfCHA-mediated transport. On the other hand, the yeast Vcx1p antiporter is known to lack Mn2+ transport [39] which is in agreement with the observed lack of suppression of the Mn2+ cytosolic peak in the cells expressing the gene product of VCX1 (Figure 3C).
Divalent cation transport activities in multi-well plates. A- C. Apoaequorin bioluminescence for cytosolic Ca2+ , Mg2+ and Mn2+, respectively. Cell cultures were distributes in 0.1 ml volumes in 96-well plates at 0.1 OD600 densities. A bolus of 0.1 ml 1 M of CaCl2, MgCl2, or MnCl2 was added at 5 seconds and the relative light units (RLUs) were recorded every 0.5 second for 60 seconds. The signals for experimental group were normalized against the RLU of the 5 second point for that group (RLUt (0 .. 22)/RLUt = 5) and the signals for the first 22 seconds are presented. D. Dual magnesium and calcium transport. Cell cultures in 0.08 ml volumes were distributed in 96-well plates at 0.1 OD600 density. MgCl2 was added (1M, 0.02 ml) at 2 seconds followed by 0.1 ml of 1M CaCl2 at 5 seconds. RLUs were normalized as in A–C. Data presented is representative of four experiments for A–C and three experiments for D.
The effective sequestration of cytosolic Mg2+ was corroborated when cells pre-loaded with Mg2+ (0.2 M final concentration) had a subsequently bolus of Ca2+ (0.5 M final concentration) (Figure 3D). The rationale behind this assay takes into account the fact that Mg2+ and Ca2+ share their binding sites in aequorin. Aequorin is known to bind other divalent cations besides Ca2+ via one or more of its three EF-hand Ca2+-binding sites and Mg2+ has been shown to compete for the same sites that Ca2+ occupies when bound to aequorin [40, 41]. Thus pre-loading with Mg2+ will be expected to reduce any signal from a subsequent Ca2+ injection if the former has not been effectively sequestered from the cytosol. Therefore, the magnitude of the luminescence signal from Ca2+ will be in proportion to the effective sequestration of Mg2+ from cytoplasm. As observed in Figure 3D the injection of Mg2+ at 2 seconds showed the expected signal in response to the presence of this divalent cation in the cytosol. When the injection of Ca2+ followed at 5 seconds, the three different cell groups presented a delayed luminescence peaks in comparison to the cells that were not pre-loaded with Mg2+ (Figure 3D). The magnitude of the luminescence peak generated by Ca2+ seems to reflect rather accurately the capacity for transport of cytoplasmic Mg2+ (Figure 3D). The Ca2+-dependent signal was respectively 12 times, 1.5 times and 3.5 times on average lower in the cells pre-loaded with Mg2+ than those that were not for vcx1Δ + p505, vcx1Δ + VCX1 and vcx1Δ + PfCHA. Magnesium was then more effectively cleared in the cells carrying PfCHA followed by the yeast vcx1p antiporter and with a significantly lack of transport for Mg2+ in the knock-out stain.
PfCHA as well as Vcx1p, however, sequestered Ca2+ at slower rates when cells had been pre-loaded with Mg2+. Yeast Vcx1p dissipated the Ca2+ signal 13 times slower on average (means 0.32 RLUs/second vs 0.025 RLUs/second) in the presence of Mg2+, with PfCHA rates of Ca2+ clearance falling to 63 times on average (means 0.44 RLUs/second vs 0.007/second) significantly slower when in the presence of Mg2+. Clearance rates for Ca2+ were calculated from the highest point to the first point of the plateau for each curve (Ca2+ only versus Ca2+ after Mg2+ load). The delayed response to cytoplasmic Ca2+ is interpreted as the time required for Ca2+ to displace Mg2+ from the aequorin EF-hand Ca2+-binding sites, and the slower clearance rates as the inhibitory effects of Mg2+ on the transport of Ca2+ by Vcx1p and PfCHA. Interestingly, by comparison PfCHA seems to be a more proficient transporter of Mg2+ given that a higher proportion was cleared from cytoplasm by PfCHA (Ca2+ peak lower in cells loaded with Mg2+). Also, PfCHA seems to have a higher affinity for Mg2+ than the yeast Vcx1p since the rate of Ca2+ sequestration of cytosolic Ca2+ in cells loaded with Mg2+ was most affected in the cells expression PfCHA. Pre-loading with Mn2+ was less informative due to the overlapping patterns with the signal generated by Ca2+ (data not shown). This is observed as the result of Mn2+ occupying a EF-hand Ca2+-binding site different from the two sites that Ca2+ binds in aequorin [23, 24].
Inhibitory assays with KB-R7943
In the absence of specific Ca2+/H+ antiporter inhibitors KB-R7943 was used to illustrate an inhibitory assay for PfCHA using the yeast expression system. KB-R7943 is an inhibitor of Na+/Ca2+ antiporters [42–44] although it inhibits more avidly members of the canonical transient receptor potential channel (TRPC) family [45]. More recently KB-R7943 was used in the functional characterization of PfCHA expressed in X. laevis oocytes [20] where it reduced by approximately half the uptake of Ca2+ at 20 μM. Here yeast cultures were incubated for 30 minutes at room temperature in several concentrations of KB-R7943 after the cells had been treated with coelenterazine as in Methods. The effect of this inhibitor on the sequestration of cytosolic Ca2+ was apparent in all three experimental groups of the vcx1Δ knock-out strain carrying the empty vector pGREG505 (vcx1Δ + p505) or expressing VCX1 (vcx1Δ + VCX1) and PfCHA (vcx1Δ + PfCHA) (Figures 4A–4C). The luminescence signals increased in proportion to the concentration of KB-R7943 in all three groups: higher peak at injection time and larger areas under the curve (AUC) throughout the detection time of 60 seconds. Next, the observed luminescence patterns were translated to inhibitory dose–response curves. The ratios of the AUC (between 4 and 16 seconds) of the luminescence signals from the DMSO controls over the AUC for the signals from the KB-R7943 samples were calculated and expressed as percentages for each of the three experimental groups (Figures 4D–4F). All three vcx1Δ yeast mutants, carrying the vector only as well as the yeast carrying Vcx1p or the Plasmodium PfCHA, had their mobilization of cytosolic Ca2+ inhibited by KB-R7943. The average concentrations (n = 4) at which their transport was inhibited by 50% (the AUC of the luminescence signal had double with respect to the DMSO sample) was calculated to be 7.5 μM, 12.5 μM and 17.5 μM of KB-R7943 for vcx1Δ + pGREG505, vcx1Δ + VCX1 and vcx1Δ + PfCHA, respectively (Figures 4D–4F). The higher sensitivity of the knock-out strain to this inhibitor in comparison to either of the vcx1Δ expressing the Ca2+/H+ antiporters from yeast or Plasmodium could be explained if the S. cerevisiae TRPC homologue Yvc1p, a vacuolar Ca2+- and mechanosensitive TRP cation channel, mediates the rapid initial response for sequestration of Ca2+ in vcx1Δ cells. TRP channels are targets of KB-R7943 and have been shown to have their current blocked by IC50 in the range of 0.46–1.38 μM of this inhibitor. These data therefore demonstrate the proof of concept that the yeast system using the vcx1Δ knock-out and apoaequorin (aequorin + coelentarazine) as a divalent cation reporter delivers a suitable screening setting for high throughput search for molecules with inhibitory activity against P. falciparum’s Ca2+/H+ antiporter PfCHA.
Calcium transport inhibition assays with KB-R7943. A – C. Ca2+ - dependent luminescence at increasing concentrations of KB-R7943. Cells were incubated for 30 minutes in 2% (v/v) DMSO (concentration of solvent in the culture with the highest concentration of KB-R7943) or in increasing concentrations of KB-R7943. The profiles for the first 30 seconds are presented for 12.5 μM, 25 μM, 50 μM, 100 μM and 200 μM of KB-R7943. CaCl2 (1 M, 0.1 ml) was added at 5 seconds to wells containing 0.1 ml of cells (0.1 OD600) and the signals recorded for 60 seconds. RLUs were normalized against the RLU of the 5 second point for that group ( RLUt (0 .. 30)/RLUt = 5 ). Data represent the averages of four experiments. D – E. Inhibitory concentrations for KB-R7943. Inhibitory assays were performed with nine concentrations at two-fold dilutions from 0.2 mM KB-R7943. Y axis: the areas under the curve (AUC) from 4 to 16 seconds for the DMSO samples were divided by the AUC for the different concentrations of KB-R7943 in each experimental group and multiplied by 100 to express the fractions as percentages. The data were fitted and the IC50 and slopes inferred with the following equation: f(x) = A2 + (A1 – A2)/(1 + (x/L) S ). Where “A2” is the limit to the left of the sigmoid (highest signal, lowest concentration), “A1” is the limit to the right (lowest signal, highest concentration), “L” is the concentration equivalent to half of the signal of the left limit (IC50), and “S” is the slope. Data represents the averages and standard deviations of four different experiments.
Cytolocalization of PfCHA in Saccharomyces cerevisiae
Using a primary antibody (Anti-PfCHA) raised against a 14 aa synthetic peptide representing residues 73-86 of PfCHA, indirect immunolocalization assays were performed in the transformed yeast. Yeast vcx1Δ mutants carrying pGREG505-PfCHA showed a fluorescent signal derived from the vacuole (tonoplast) (Figure 5A, bottom panels) while the control samples using the strain carrying pGREG505-VCX1 (Figure 5A, top panels) failed to generate the same fluorescent signal. The specificity of the Anti-PfCHA used here was assessed probing blots with membrane-enriched fractions of the same vcx1Δ mutant expressing the recombinants VCX1 or PfCHA (Figure 5B). These observations in addition to the functional data presented above, indicate that in contrast to the mitochondria localization of PfCHA in P. falciparum and in the plasma membrane when expressed X. laevis[20], in S. cerevisiae the same protein is sorted to the vacuole membrane.
PfCHA protein localizes to the yeast vacuole membrane. A. Indirect immunofluorescence assay with Anti-PfCHA in yeast vcx1Δ expressing the recombinants pGREG505-VCX1 and pGREG505-PfCHA. Bright field, dark field, and the merge in columns from left to right. Top panels show a sample from cells carrying pGREG505-VCX1 and stained with propidium iodide for staining of the nucleus in addition to the primary Anti-PfCHA. Bottom panels shown FITC fluorescence localizing around the yeast tonoplast of vcx1Δ cells carrying pGREG505-PfCHA and probed with Anti-PfCHA (1:100). B. Anti-PfCAX Western Blot. Top panel shows the signal given by Anti-PfCHA on the yeast membrane extracts. The expected molecular size for PfCHA is approximately 49kDa. Samples are labelled as the yeast vcx1Δ mutant carrying the empty pGREG505 vector (p505), or the recombinant pGREG-VCX1 or pGREG-PfCHA vectors. Bottom panel show the control with Anti-actin antibody. Molecular mass markers as indicated.
Discussion
A transient rise in cytosolic free Ca2+ generated when influx temporarily exceeds efflux usually functions as an intracellular signal. Calcium-proton exchangers are low-affinity cytosolic export systems that coupled to the thermodynamically downhill exchange flux of H+ dissipate cytosolic increases of Ca2+[21]. PfCHA is part of the CAXs (for CAtion eXchangers) group of integral membrane proteins that transport Ca2+ energized by the electrochemical gradient established by proton pumps such as H+-ATPases and H+-pyrophosphatases [17]. Accordingly, CAX proteins had previously been located in acidic compartments in plants [17] and yeast [21] where they sequester calcium from the cytoplasm. In P. falciparum however, the CAX homologue PfCHA seems to localize and perform Ca2+ (as well as Mn2+) exchange in the mitochondrion of this parasite [20]. In this organelle PfCHA is proposed to mediate the extrusion of peaks of Ca2+ from the matrix when the mitochondrion is going through transient Ca2+ overloads [20].
In order to detect functional PfCHA in S. cerevisiae, the apoaequorin luminescent response to divalent cations was used as a reporter system to follow cytosolic levels of Ca2+, Mg2+ and Mn2+[29]. Apoaequorin bioluminescence assays in yeast have been applied in studies of cellular Ca2+ homeostasis [34, 46], including the functional characterization of heterologous Ca2+ transporters such as the A. thaliana Ca2+/H+ antiporters (AtCAX) [47]. Here, PfCHA was shown to rescue the ability to mediate the dissipation of cytosolic peaks of Ca2+, Mg2+ and Mn2+ in the yeast vcx1Δ mutant and that this activity was sensitive to inhibition of the H+ transmembrane gradient by a vacuolar-ATPase inhibitor as well as the Na+/H+ antiporter and TRP channels inhibitor KB-R7943. The levels of cytosolic Ca2+, Mg2+ and Mn2+ reported by the apoaequorin luminescence show apparent and significant cytosolic dissipation of all three of these divalent cations by PfCHA in vcx1Δ cells. Taken together, the functional data and immunolocalization point at PfCHA to behave as a divalent cation/H+ exchanger that in yeast functions as a vacuolar membrane transporter. As a consequence of the role of the proton gradient in the function of this type of calcium exchanger potential inhibitors of PfCHA will have to be tested for their own capacity to inhibit proton pumps.
In yeast it is estimated that at least 90% of the total 1.5-4 mM of cellular Ca2+ is sequestered within the yeast vacuole in stable complexes (e.g. with polyphosphates) as well as free Ca2+[48] allowing the cell basal cytosolic levels to be kept around 50-80 nM. The accumulation of vacuolar Ca2+ in yeast is maintained through the complementary action of Vcx1p [48, 49] and the Ca2+ ATPase Pmc1p [50]. As with other CAX proteins Vcx1p is a low affinity high capacitance facilitative Ca2+ transporter that responds to sudden increments of the cytosolic Ca2+ by rapid sequestration of this cation into the vacuole in exchange for two protons down a proton gradient (vacuolar pH 5.5-6.2 vs cytoplasmic pH 7.0) [38, 51].
It is noteworthy that in S. cerevisiae, cells have to be exposed to seemingly excessive concentrations of these cations (50 mM to 500 mM external levels of their chloride salts) in order to reach measurable cytosolic transient elevations of these ions. When exposed to 50 mM S. cerevisiae cytosolic levels of Ca2+ are measured to be in the region of 250-290 nM (basal concentrations 50–80 nM) that increases further to 320-350 nM when the external Ca2+ is raised to 400 mM [34]. The vcx1Δ mutant undergoes transient elevations slightly higher with cytosolic calcium concentrations of approximately 400 nM and 510 nM when in the presence of 50 mM and 400 mM of Ca2+, respectively [34]. Coincidentally, these cytosolic concentrations of Calcium are far from the 2 mM reported as the Km of PfCHA for Ca2+[20], or the Km for Ca2+ reported for other CAX proteins (up to 25μM) [21]. Nonetheless, the rates of divalent cations transported by PfCHA effectively dissipated 40 – 55% of the cytosolic transient elevations in the vcx1Δ background (Figures 1-Figure 3).
The localization of PfCHA to the yeast vacuole is not altogether surprising as this organelle seems to be the default localization for foreign proteins in S. cerevisiae. In S. cerevisiae proteins are sorted to the vacuole by at least four different pathways [52]: (i) sorting of vacuolar proteins vs cell surface proteins in the early stages of the secretory pathway, (ii) endocytic engulfing of material from the plasma membrane, (iii) cytoplasm-to-vacuole targeting pathways that do not transit the early stages of the secretory pathway, and (iv) the de facto inheritance of vacuolar material by daughter cells during cell division. However, in S. cerevisiae membrane proteins lacking motifs or otherwise protein structure information for cellular localization are predominantly delivered to the vacuole membrane [53, 54]. Moreover, membrane proteins have been shown to be delivered by default to the yeast vacuole when high levels of protein expression – overexpression – are achieved. The localization of membrane proteins depends also on the length of their transmembrane domains [53], it is not possible to know a priori the destination of a membrane transporter in a heterologous expression system. In the yeast expression system as reported here it is speculated that PfCHA is sorted by a default mechanism to the yeast vacuole [55].
In eukaryotic cell hosts, the yeast S. cerevisiae is by far the most advantageous gene expression system since it is relatively inexpensive to culture and it is the most genetically tractable eukaryotic system with excellent recombinant DNA tools. Additionally, recent advances seeking to overcome the difficulties intrinsic to the expression of foreign proteins in yeast, particularly membrane proteins, have rendered transgenic strains with altered ribosomal content that seems to tolerate and much improve heterologous gene overexpression [56, 57]. The successful expression of PfCHA in S. cerevisiae and its localization to the yeast vacuole permits a very tractable system for further functional and pharmacological studies as exemplified here in multi-well whole-cell cation transport and inhibitory assays.
Conclusions
Yeast offers a cost-effective and user-friendly gene expression system for further functional studies and pharmacological screens of proteins from P. falciparum. Particularly membrane transporters such as PfCHA that are still very seldom successfully expressed in heterologous hosts. Moreover, the bioluminescence assay for the detection of cytoplasmic Ca2+ as well as Mg2+ and Mn2+ lends itself to high-throughput and quantitative settings.
Abbreviations
- PfCHA:
-
Plasmodium falciparum Ca2+/H+ antiporter
- VCX1:
-
Saccharomyces cerevisiae; Ca2+/H+ antiporter
- RLU:
-
Relative Light Units.
References
Raventos Suarez C, Bookchin RM, Lew D, Nagel R, Lew VL: Ca2+ is required forreinfection of red cells by Plasmodium falciparum. Fed Proc. 1982, 41: 1121-
Singh S, Alam MM, Pal-Bhowmick I, Brzostowski JA, Chitnis CE: Distinct external signals trigger sequential release of apical organelles during erythrocyte invasion by malaria parasites. PLoS Pathog. 2010, 6: e1000746-10.1371/journal.ppat.1000746.
Wasserman M, Chaparro J: Intraerythrocytic calcium chelators inhibit the invasion of Plasmodium falciparum. Parasitol Res. 1996, 82: 102-107. 10.1007/s004360050078.
Hotta CT, Gazarini ML, Beraldo FH, Varotti FP, Lopes C, Markus RP, Pozzan T, Garcia CR: Calcium-dependent modulation by melatonin of the circadian rhythm in malarial parasites. Nat Cell Biol. 2000, 2: 466-468. 10.1038/35017112.
Billker O, Dechamps S, Tewari R, Wenig G, Franke-Fayard B, Brinkmann V: Calcium and a calcium-dependent protein kinase regulate gamete formation and mosquito transmission in a malaria parasite. Cell. 2004, 117: 503-514. 10.1016/S0092-8674(04)00449-0.
Ishino T, Orito Y, Chinzei Y, Yuda M: A calcium-dependent protein kinase regulates Plasmodium ookinete access to the midgut epithelial cell. Mol Microbiol. 2006, 59: 1175-1184. 10.1111/j.1365-2958.2005.05014.x.
Ono T, Cabrita-Santos L, Leitao R, Bettiol E, Purcell LA, Diaz-Pulido O, Andrews LB, Tadakuma T, Bhanot P, Mota MM, Rodriguez A: Adenylyl cyclase alpha and cAMP signaling mediate Plasmodium sporozoite apical regulated exocytosis and hepatocyte infection. PLoS Pathog. 2008, 4: e1000008-10.1371/journal.ppat.1000008.
Alleva L, Kirk K: Calcium regulation in the intraerythrocytic malaria parasite Plasmodium falciparum. Mol Biochem Parasitol. 2001, 117: 121-128. 10.1016/S0166-6851(01)00338-3.
Biagini G, Bray P, Spiller D, White M, Ward S: The digestive food vacuole of the malaria parasite is a dynamic intracellular Ca2+ store. J Biol Chem. 2003, 278: 27910-27915. 10.1074/jbc.M304193200.
Krishna S, Woodrow C, Webb R, Penny J, Takeyasu K, Kimura M, East JM: Expression and functional characterization of a Plasmodium falciparum Ca2 + - ATPase (PfATP4) belonging to a subclass unique to apicomplexan organisms. J Biol Chem. 2001, 276: 10782-10787. 10.1074/jbc.M010554200.
Eckstein-Ludwig U, Webb RJ, Van Goethem ID, East JM, Lee AG, Kimura M, O'Neill PM, Bray PG, Ward SA, Krishna S: Artemisinins target the SERCA of Plasmodium falciparum. Nature. 2003, 424: 957-961. 10.1038/nature01813.
Kimura M, Yamaguchi Y, Takada S, Tanabe K: Cloning of a Ca(2+)-ATPase gene of Plasmodium falciparum and comparison with vertebrate Ca(2+)-ATPases. J Cell Sci. 1993, 104: 1129-1136.
Marchesini N, Luo S, Rodrigues CO, Moreno SN, Docampo R: Acidocalcisomes and a vacuolar H + -pyrophosphatase in malaria parasites. Biochem J. 2000, 347 (Pt 1): 243-253.
Ruiz FA, Luo S, Moreno SNJ, Docampo R: Polyphosphate Content and Fine Structure of Acidocalcisomes of Plasmodium falciparum. Microsc Microanal. 2004, 10: 563-567.
Gazarini ML, Garcia CR: The malaria parasite mitochondrion senses cytosolic Ca2+ fluctuations. Biochem Biophys Res Commun. 2004, 321: 138-144. 10.1016/j.bbrc.2004.06.141.
Rohrbach P, Friedrich O, Hentschel J, Plattner H, Fink RHA, Lanzer M: Quantitative calcium measurements in subcellular compartments of Plasmodium falciparum-infected erythrocytes. J Biol Chem. 2005, 280: 27960-27969. 10.1074/jbc.M500777200.
Shigaki T, Hirschi KD: Diverse functions and molecular properties emerging for cax cation/h + exchangers in plants. Plant Biol. 2006, 8: 419-429. 10.1055/s-2006-923950.
Shigaki T, Rees I, LN , Hirschi KD: Identification of three distinct phylogeneticgroups of CAX cation/proton antiporters. J Mol Evol. 2006, 63: 815-825. 10.1007/s00239-006-0048-4.
Saier MHJ: A functional-phylogenetic classification system for transmembrane solute transporters. Microbiol Mol Biol Rev. 2000, 64: 354-411. 10.1128/MMBR.64.2.354-411.2000.
Rotmann A, Sanchez C, Guiguemde A, Rohrbach P, Dave A, Bakouh N, Planelles G, Lanzer M: PfCHA is a mitochondrial divalent cation/H + antiporter in Plasmodium falciparum. Mol Microbiol. 2010, 76: 1591-1606. 10.1111/j.1365-2958.2010.07187.x.
Pittman JK: Vacuolar Ca2+ uptake. Cell Calcium. 2011, 50: 139-146. 10.1016/j.ceca.2011.01.004.
Ton V, Rao R: Functional expression of heterologous proteins in yeast: insights into Ca2+ signaling and Ca2 + -transporting ATPases. Am J Physiol Cell Physiol. 2004, 287: C580-C589. 10.1152/ajpcell.00135.2004.
Izutsu K, Felton S, Siegel I, Yoda W, Chen A: Aequorin: Its ionic specificity. Biochem Biophys Res Commun. 1972, 49: 1034-1039. 10.1016/0006-291X(72)90316-6.
Kemple MD, Lovejoy ML, Ray BD, Prendergast FG, Nageswara Rao BD: Mn(II)-EPR measurements of cation binding by aequorin. Eur J Biochem. 1990, 187: 131-135. 10.1111/j.1432-1033.1990.tb15286.x.
Trager W, Jensen JB: Human malaria parasites in continuous culture. Science. 1976, 193: 673-675. 10.1126/science.781840.
Aurrecoechea C, Brestelli J, Brunk BP, Dommer J, Fischer S, Gajria B, Gao X, Gingle A, Grant G, Harb OS, Heiges M, Innamorato F, Iodice J, Kissinger JC, Kraemer E, Li W, Miller JA, Nayak V, Pennington C, Pinney DF, Roos DS, Ross C, Stoeckert , Christian J, Treatman C, Wang H: PlasmoDB: a functional genomicdatabase for malaria parasites. Nucleic Acids Res. 2009, 37: D539-D543. 10.1093/nar/gkn814.
Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Wheeler DL: GenBank. Nucleic Acids Res. 2008, 36: D25-D30. 10.1093/nar/gkn320.
Jansen G, Wu C, Schade B, Thomas DY, Whiteway M: Drag&Drop cloning in yeast. Gene. 2005, 344: 43-51.
Nakajima-Shimada J, Iida H, Tsuji F, Anraku Y: Monitoring of intracellular calcium in Saccharomyces cerevisiae with an apoaequorin cDNA expression system. Proc Natl Acad Sci U S A. 1991, 88: 6878-6882. 10.1073/pnas.88.15.6878.
European Saccharomyces cerevisiae archive for functional analysis. web.uni-frankfurt.de/fb15/mikro/euroscarf/
Saccharomyces Genome Database.www.yeastgenome.org/,
Hill J, Donald KG, Griffiths DE: DMSO-enhanced whole cell yeast transformation. Nucleic Acids Res. 1991, 19: 5791-10.1093/nar/19.20.5791.
Ausubel F, Brent R, Kingston R, Moore D, Seidman J, Smith J, Struhl K: Shortprotocols in molecular biology. 2002, Wiley
Miseta A, Kellermayer R, Aiello DP, Fu LW, Bedwell DM: The vacuolar Ca2+/H+exchanger Vcx1p/Hum1p tightly controls cytosolic Ca2+ levels in S. cerevisiae. FEBS Lett. 1999, 451: 132-136. 10.1016/S0014-5793(99)00519-0.
Fisher N, Warman AJ, Ward SA, Biagini GA: Type II NADH: Quinone oxidoreductases of Plasmodium falciparum and Mycobacterium tuberculosis: kinetic and high-throughput assays. Methods Enzymol. 2009, 456: 303-320.
Stearman R, Yuan DS, Yamaguchi-lwai Y, Klausner RD, Dancis A: A Permease- oxidase complex involved in high-affinity iron uptake in yeast. Science. 1996, 271: 1552-1557. 10.1126/science.271.5255.1552.
Salcedo E, Cortese JF, Plowe CV, Sims PFG, Hyde JE: A bifunctional dihydrofolate synthetase-folylpolyglutamate synthetase in Plasmodium falciparum identified by functional complementation in yeast and bacteria. Mol Biochem Parasitol. 2001, 112: 239-252. 10.1016/S0166-6851(00)00370-4.
Preston R, Murphy R, Jones E: Assay of vacuolar pH in yeast and identification of acidification-defective mutants. Proc Natl Acad Sci U S A. 1989, 86: 7027-7031. 10.1073/pnas.86.18.7027.
Pittman JK, Cheng NH, Shigaki T, Kunta M, Hirschi KD: Functional dependence on calcineurin by variants of the Saccharomyces cerevisiae vacuolar Ca2+/H + exchanger Vcx1p. Mol Microbiol. 2004, 54: 1104-1116. 10.1111/j.1365-2958.2004.04332.x.
Jones K, Hibbert F, Keenan M: Glowing jellyfish, luminescence and a molecule called coelenterazine. Trends Biotechnol. 1999, 17: 477-481. 10.1016/S0167-7799(99)01379-7.
Kendall JM, Badminton MN: Aequorea victoria bioluminescence moves into an exciting new era. Trends Biotechnol. 1998, 16: 216-224. 10.1016/S0167-7799(98)01184-6.
Elias CL, Lukas A, Shurraw S, Scott J, Omelchenko A, Gross GJ, Hnatowich M, Hryshko LV: Inhibition of Na+/Ca2+ exchange by KB-R7943: transport mode selectivity and antiarrhythmic consequences. Am J Physiol Heart Circ Physiol. 2001, 281: H1334-H1345.
Iwamoto T, Watano T, Shigekawa M: A novel isothiourea derivative selectively inhibits the reverse mode of Na+/Ca2+ Exchange in Cells Expressing NCX1. J Biol Chem. 1996, 271: 22391-22397. 10.1074/jbc.271.37.22391.
Watano T, Kimura J, Nakanishi H: A novel antagonist, No. 7943, of the Na+/Ca2+ exchange current in guinea-pig cardiac ventricular cells. Br J Pharmacol. 1996, 119: 555-563. 10.1111/j.1476-5381.1996.tb15708.x.
Kraft R: The Na+/Ca2+ exchange inhibitor KB-R7943 potently blocks TRPC channels. Biochem Biophys Res Commun. 2007, 361: 230-236. 10.1016/j.bbrc.2007.07.019.
Batiza A, Schulz T, Masson P: Yeast respond to hypotonic shock with a Calcium pulse. J Biol Chem. 1996, 271: 23357-23362. 10.1074/jbc.271.38.23357.
Hirschi KD, Zhen RG, Cunningham KW, Rea PA, Fink GR: CAX1, an H+/Ca2+ antiporter from Arabidopsis. Proc Natl Acad Sci U S A. 1996, 93: 8782-8786. 10.1073/pnas.93.16.8782.
Cunningham KW, Fink GR: Calcineurin inhibits VCX1-dependent H+/Ca2+ exchange and induces Ca2+ ATPases in Saccharomyces cerevisiae. Mol Cell Biol. 1996, 16: 2226-2237.
Pozos TC, Sekler I, Cyert MS: The product of HUM1, a novel yeast gene, is required for vacuolar Ca2+/H + exchange and is related to mammalian Na+/Ca2+ exchangers. Mol Cell Biol. 1996, 16: 3730-3741.
Cunningham KW, Fink GR: Calcineurin-dependent growth control in Saccharomyces cerevisiae mutants lacking PMC1, a homolog of plasma membrane Ca2+ ATPases. J Cell Biol. 1994, 124: 351-363. 10.1083/jcb.124.3.351.
Carmelo V, Santos H, Sa-Correia I: Effect of extracellular acidification on the activity of plasma membrane ATPase and on the cytosolic and vacuolar pH of Saccharomyces cerevisiae. Biochim Biophys Acta - Biomembranes. 1997, 1325: 63-70. 10.1016/S0005-2736(96)00245-3.
Bryant NJ, Stevens TH: Vacuole biogenesis in Saccharomyces cerevisiae: protein transport pathways to the yeast vacuole. Microbiol Mol Biol Rev. 1998, 62: 230-247.
Rayner JC, Pelham HRB: Transmembrane domain-dependent sorting of proteins to the ER and plasma membrane in yeast. EMBO J. 1997, 16: 1832-1841. 10.1093/emboj/16.8.1832.
Wilcox CA, Redding K, Wright R, Fuller RS: Mutation of a tyrosine localization signal in the cytosolic tail of yeast Kex2 protease disrupts Golgi retention and results in default transport to the vacuole. Mol Biol Cell. 1992, 3: 1353-1371.
Roberts CJ, Nothwehr SF, Stevens TH: Membrane protein sorting in the yeast secretory pathway: evidence that the vacuole may be the default compartment. J Cell Biol. 1992, 119: 69-83. 10.1083/jcb.119.1.69.
Ashe MP, Bill RM: Mapping the yeast host cell response to recombinant membrane protein production: Relieving the biological bottlenecks. Biotechnol J. 2011, 6: 707-714. 10.1002/biot.201000333.
Bawa Z, Bland CE, Bonander N, Bora N, Cartwright SP, Clare M, Conner MT, Darby RA, Dilworth MV, Holmes WJ, Jamshad M, Routledge SJ, Gross SR, Bill RM: Understanding the yeast host cell response to recombinant membrane protein production. Biochem Soc Trans. 2011, 39: 719-723.
Acknowledgement
This work was supported by the MRC grant G0400173.
Author information
Authors and Affiliations
Corresponding authors
Additional information
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
JES-S designed the study and performed experiments. JES-S and GAB wrote the initial draft of the manuscript. SAW and GAB edited and revised the manuscript, and provided materials and equipment. All authors read and approved the final manuscript.
Electronic supplementary material
12936_2012_2450_MOESM1_ESM.pdf
Additional file 1: PfCHA and VCX1 RNA yeast expression. A. The expression of Plasmodium PfCHA as well as yeast VCX1 was observed by reverse transcription PCR using total RNA from the reference strain BY4741n, the vcx1Δ mutant carrying the expression plasmid only (p505) and the same mutant carrying the recombinant plasmid with either VCX1 or PfCHA. Forward and reverse primer position and sequences: PfCHA (64 - 488nt) (5’- AAAAATGTGCCCCCTATGAA, 5’-TCCATTAAATTACCAAACGTAGCA), VCX1 (269 - 666nt) (5’-GTAACACCATTGGGGGACTG, 5’-ATGGCTCCCTAGCTGGAAAT), and yeast S. cerevisiae actin YFL039c (130 - 533 nt) (5’- ATGGTCGGTATGGGTCAAAA, 5’- ATTCTCAAAATGGCGTGAGG). B. Real-time PCR using total RNA from the vcx1Δ mutant carrying recombinant plasmids with VCX1 or PfCHA following the amplification of either a fragment or the full gene for VCX1– 666 bp and VCX1-1236 bp respectively. Likewise for the PfCHA (488 bp fragment or entire gene of 1321 bp). Primers for total length genes as in Methods. Evidently, RNA levels of PfCHA as full size gene are present around three-fold lower than its homologous counterpart VCX1 while the difference in the levels of shorter (truncated) transcribed fragments is only half that difference. (PDF 199 KB)
12936_2012_2450_MOESM2_ESM.pdf
Additional file 2: Phenotypic rescue of yeast Saccharomyces cerevisiae vcx1Δ inhibited in presence of glucose. Conditions and strains as in Figure 1A except that the culture medium contained D-glucose instead of D-galactose which suppresses the activity of the GAL1 promoter present in pGREG505. (PDF 18 KB)
Authors’ original submitted files for images
Below are the links to the authors’ original submitted files for images.
Rights and permissions
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
About this article
Cite this article
Salcedo-Sora, J.E., Ward, S.A. & Biagini, G.A. A yeast expression system for functional and pharmacological studies of the malaria parasite Ca2+/H+ antiporter. Malar J 11, 254 (2012). https://doi.org/10.1186/1475-2875-11-254
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/1475-2875-11-254